Incidental Mutation 'R2394:Itsn2'
ID247923
Institutional Source Beutler Lab
Gene Symbol Itsn2
Ensembl Gene ENSMUSG00000020640
Gene Nameintersectin 2
SynonymsSh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Ese2, Sh3p18
MMRRC Submission 040362-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2394 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location4592638-4713962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4707005 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 1365 (S1365Y)
Ref Sequence ENSEMBL: ENSMUSP00000151896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000219007] [ENSMUST00000220311]
Predicted Effect probably benign
Transcript: ENSMUST00000062580
AA Change: S1338Y

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640
AA Change: S1338Y

DomainStartEndE-ValueType
EH 15 109 8.44e-41 SMART
EFh 58 86 7.18e-3 SMART
low complexity region 156 169 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
EH 238 333 4.06e-43 SMART
EFh 282 310 6.16e-2 SMART
coiled coil region 366 462 N/A INTRINSIC
coiled coil region 516 556 N/A INTRINSIC
coiled coil region 580 715 N/A INTRINSIC
SH3 721 778 2.65e-21 SMART
low complexity region 791 811 N/A INTRINSIC
SH3 855 909 8.83e-18 SMART
SH3 945 999 9.1e-20 SMART
SH3 1017 1077 1.55e-13 SMART
SH3 1091 1146 7.22e-23 SMART
RhoGEF 1174 1355 1.93e-56 SMART
PH 1396 1507 1.16e-9 SMART
C2 1531 1628 3.96e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218923
Predicted Effect probably benign
Transcript: ENSMUST00000219007
AA Change: S1338Y

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219832
Predicted Effect possibly damaging
Transcript: ENSMUST00000220311
AA Change: S1365Y

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal brain morphology and function and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,216 probably null Het
Atxn7 T C 14: 14,100,237 V641A probably damaging Het
C3 G A 17: 57,222,303 Q30* probably null Het
Ccdc162 A G 10: 41,569,898 I426T probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cwc27 A C 13: 104,796,434 D253E probably benign Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dmbt1 T A 7: 131,094,734 Y892* probably null Het
Dnhd1 T A 7: 105,720,231 Y4354N probably benign Het
Dync2li1 T A 17: 84,644,747 I202K possibly damaging Het
Dyrk1a T A 16: 94,685,132 V446E probably benign Het
Fam186b T C 15: 99,280,177 I423V probably benign Het
Gm11639 C A 11: 104,738,295 T933K probably benign Het
Gm5108 T C 5: 67,975,132 probably benign Het
Htr3a A G 9: 48,906,343 V110A probably benign Het
Lrrc46 T C 11: 97,038,831 I60V probably damaging Het
Nlrp14 T C 7: 107,197,824 V307A probably benign Het
Nt5c2 A G 19: 46,890,067 probably null Het
Obox2 C T 7: 15,397,010 P56S possibly damaging Het
Olfml2b A G 1: 170,649,750 I151M possibly damaging Het
Oog3 T A 4: 144,159,314 D238V probably benign Het
Pde11a T C 2: 76,059,061 T690A probably benign Het
Ppa1 A G 10: 61,672,384 probably benign Het
Ppfia2 A G 10: 106,819,490 E306G probably damaging Het
Ppic G A 18: 53,411,047 R89C probably damaging Het
Ptprk T G 10: 28,551,717 I764S probably damaging Het
Ripk2 T C 4: 16,132,774 probably benign Het
Rnf123 A G 9: 108,063,536 M702T probably benign Het
Skiv2l2 A T 13: 112,883,168 Y803N probably benign Het
Slco1b2 T C 6: 141,669,374 I335T probably damaging Het
Ssbp1 T A 6: 40,476,809 D96E probably benign Het
Thap8 A T 7: 30,280,628 probably benign Het
Tpp2 T A 1: 43,983,186 S915T possibly damaging Het
Unc5c A T 3: 141,678,131 Q90L probably damaging Het
Vmn2r57 A G 7: 41,400,195 I710T possibly damaging Het
Wdr90 G A 17: 25,851,455 P1104L probably damaging Het
Other mutations in Itsn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Itsn2 APN 12 4658027 missense possibly damaging 0.95
IGL00647:Itsn2 APN 12 4613311 splice site probably benign
IGL00933:Itsn2 APN 12 4707540 missense probably damaging 1.00
IGL01686:Itsn2 APN 12 4636693 splice site probably benign
IGL01873:Itsn2 APN 12 4632366 splice site probably benign
IGL02200:Itsn2 APN 12 4636632 missense probably damaging 0.98
IGL02280:Itsn2 APN 12 4708961 missense possibly damaging 0.89
IGL02388:Itsn2 APN 12 4629557 missense possibly damaging 0.91
IGL02938:Itsn2 APN 12 4697216 missense probably damaging 0.98
inversus UTSW 12 4639670 nonsense probably null
liberator UTSW 12 4666176 nonsense probably null
rolled UTSW 12 4634792 nonsense probably null
stratofortress UTSW 12 4624927 missense probably damaging 1.00
R0101:Itsn2 UTSW 12 4633058 unclassified probably benign
R0268:Itsn2 UTSW 12 4700333 missense probably benign 0.12
R0584:Itsn2 UTSW 12 4697180 missense probably benign
R0604:Itsn2 UTSW 12 4658189 missense probably benign 0.01
R0639:Itsn2 UTSW 12 4712556 missense probably damaging 0.99
R0738:Itsn2 UTSW 12 4635681 missense probably benign 0.17
R1132:Itsn2 UTSW 12 4658464 missense probably damaging 1.00
R1163:Itsn2 UTSW 12 4712009 missense probably benign 0.30
R1169:Itsn2 UTSW 12 4639694 missense probably damaging 1.00
R1258:Itsn2 UTSW 12 4673464 missense probably damaging 1.00
R1297:Itsn2 UTSW 12 4700378 missense probably damaging 1.00
R1423:Itsn2 UTSW 12 4673572 missense probably damaging 0.97
R1572:Itsn2 UTSW 12 4650044 missense probably benign 0.03
R1601:Itsn2 UTSW 12 4658452 missense probably benign 0.01
R1628:Itsn2 UTSW 12 4629652 missense probably benign
R1650:Itsn2 UTSW 12 4637767 missense probably damaging 0.97
R1752:Itsn2 UTSW 12 4711950 splice site probably null
R1758:Itsn2 UTSW 12 4658160 missense possibly damaging 0.83
R1942:Itsn2 UTSW 12 4639670 nonsense probably null
R1976:Itsn2 UTSW 12 4672733 splice site probably benign
R2000:Itsn2 UTSW 12 4666176 nonsense probably null
R2060:Itsn2 UTSW 12 4627879 missense probably damaging 1.00
R2119:Itsn2 UTSW 12 4707025 missense probably benign 0.32
R2168:Itsn2 UTSW 12 4633044 unclassified probably benign
R2860:Itsn2 UTSW 12 4700315 splice site probably benign
R2861:Itsn2 UTSW 12 4700315 splice site probably benign
R2900:Itsn2 UTSW 12 4630713 unclassified probably benign
R2991:Itsn2 UTSW 12 4658474 missense probably benign 0.01
R3087:Itsn2 UTSW 12 4666303 missense probably damaging 1.00
R3881:Itsn2 UTSW 12 4634546 unclassified probably benign
R4022:Itsn2 UTSW 12 4624927 missense probably damaging 1.00
R4332:Itsn2 UTSW 12 4712611 missense possibly damaging 0.72
R4657:Itsn2 UTSW 12 4713197 makesense probably null
R4727:Itsn2 UTSW 12 4707660 missense probably damaging 0.99
R4745:Itsn2 UTSW 12 4661944 missense probably damaging 1.00
R4770:Itsn2 UTSW 12 4627892 missense probably damaging 1.00
R4905:Itsn2 UTSW 12 4634583 unclassified probably benign
R5269:Itsn2 UTSW 12 4633553 unclassified probably benign
R5314:Itsn2 UTSW 12 4627960 missense probably benign 0.09
R5345:Itsn2 UTSW 12 4672783 missense probably damaging 1.00
R5399:Itsn2 UTSW 12 4653535 missense probably benign 0.22
R5566:Itsn2 UTSW 12 4626554 missense probably damaging 1.00
R5725:Itsn2 UTSW 12 4630767 unclassified probably benign
R5773:Itsn2 UTSW 12 4707089 missense probably damaging 1.00
R6116:Itsn2 UTSW 12 4629939 unclassified probably benign
R6254:Itsn2 UTSW 12 4624982 splice site probably null
R6325:Itsn2 UTSW 12 4706351 missense probably damaging 1.00
R6361:Itsn2 UTSW 12 4629655 missense probably benign 0.18
R6456:Itsn2 UTSW 12 4629923 unclassified probably benign
R6494:Itsn2 UTSW 12 4634792 nonsense probably null
R6854:Itsn2 UTSW 12 4652382 missense probably benign 0.37
R6941:Itsn2 UTSW 12 4629641 missense probably benign 0.05
R6961:Itsn2 UTSW 12 4673420 nonsense probably null
R7326:Itsn2 UTSW 12 4632985 missense unknown
R7387:Itsn2 UTSW 12 4639781 missense probably damaging 1.00
R7465:Itsn2 UTSW 12 4706983 nonsense probably null
R7471:Itsn2 UTSW 12 4708198 missense probably benign 0.43
Z1088:Itsn2 UTSW 12 4712472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGGACTGTGGGACTCTG -3'
(R):5'- GAGCTCACACAGTGAAGTCCATG -3'

Sequencing Primer
(F):5'- GACTGTGGGACTCTGCTTCC -3'
(R):5'- TCACACAGTGAAGTCCATGCTAGG -3'
Posted On2014-11-11