Incidental Mutation 'R2405:Slc25a25'
ID247942
Institutional Source Beutler Lab
Gene Symbol Slc25a25
Ensembl Gene ENSMUSG00000026819
Gene Namesolute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25
Synonyms1110030N17Rik
MMRRC Submission 040371-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2405 (G1)
Quality Score212
Status Not validated
Chromosome2
Chromosomal Location32414487-32451445 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 32417719 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028160] [ENSMUST00000052119] [ENSMUST00000113307] [ENSMUST00000113308] [ENSMUST00000113310] [ENSMUST00000136361] [ENSMUST00000153886]
Predicted Effect probably null
Transcript: ENSMUST00000028160
SMART Domains Protein: ENSMUSP00000028160
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
EFh 48 76 8.73e0 SMART
EFh 84 112 2.64e-1 SMART
EFh 115 143 1.36e0 SMART
Blast:EFh 151 191 1e-9 BLAST
Pfam:Mito_carr 227 320 1.7e-26 PFAM
Pfam:Mito_carr 321 413 6.4e-26 PFAM
Pfam:Mito_carr 418 512 9.9e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000052119
SMART Domains Protein: ENSMUSP00000060581
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EFh 71 99 4.53e0 SMART
EFh 102 130 1.36e0 SMART
Blast:EFh 138 178 2e-9 BLAST
Pfam:Mito_carr 214 307 1.2e-26 PFAM
Pfam:Mito_carr 308 400 2.5e-27 PFAM
Pfam:Mito_carr 405 500 4.9e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113307
SMART Domains Protein: ENSMUSP00000108932
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
EFh 51 79 9.51e0 SMART
EFh 82 110 1.36e0 SMART
EFh 118 146 8.82e1 SMART
Pfam:Mito_carr 182 275 1.1e-26 PFAM
Pfam:Mito_carr 276 368 2.2e-27 PFAM
Pfam:Mito_carr 373 468 4.4e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113308
SMART Domains Protein: ENSMUSP00000108933
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EFh 71 99 4.53e0 SMART
EFh 102 130 1.36e0 SMART
EFh 138 166 8.82e1 SMART
Pfam:Mito_carr 202 295 1.1e-26 PFAM
Pfam:Mito_carr 296 388 2.4e-27 PFAM
Pfam:Mito_carr 393 488 4.7e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113310
SMART Domains Protein: ENSMUSP00000108936
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
EFh 48 76 8.73e0 SMART
EFh 84 112 2.64e-1 SMART
EFh 115 143 1.36e0 SMART
EFh 151 179 8.82e1 SMART
Pfam:Mito_carr 215 308 1.2e-26 PFAM
Pfam:Mito_carr 309 401 2.5e-27 PFAM
Pfam:Mito_carr 406 501 4.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127961
SMART Domains Protein: ENSMUSP00000121932
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
EFh 36 64 8.99e0 SMART
EFh 67 95 1.36e0 SMART
Blast:EFh 103 143 1e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128611
Predicted Effect probably null
Transcript: ENSMUST00000136361
SMART Domains Protein: ENSMUSP00000115617
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
EFh 36 64 8.99e0 SMART
EFh 67 95 1.36e0 SMART
EFh 103 131 8.82e1 SMART
Pfam:Mito_carr 167 260 9.3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153782
Predicted Effect probably benign
Transcript: ENSMUST00000153886
SMART Domains Protein: ENSMUSP00000141486
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
SCOP:d1exra_ 1 38 1e-4 SMART
Blast:EFh 15 43 2e-13 BLAST
Pfam:Mito_carr 79 112 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of calcium-binding mitochondrial carriers, with a characteristic mitochondrial carrier domain at the C-terminus. These proteins are found in the inner membranes of mitochondria, and function as transport proteins. They shuttle metabolites, nucleotides and cofactors through the mitochondrial membrane and thereby connect and/or regulate cytoplasm and matrix functions. This protein may function as an ATP-Mg/Pi carrier that mediates the transport of Mg-ATP in exchange for phosphate, and likely responsible for the net uptake or efflux of adenine nucleotides into or from the mitochondria. Alternatively spliced transcript variants encoding different isoforms with a common C-terminus but variable N-termini have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced physical endurance and metabolic efficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Abl1 T C 2: 31,800,974 L835P possibly damaging Het
Ascc3 T A 10: 50,731,678 V1426D probably damaging Het
Ccny A G 18: 9,353,480 Y98H probably benign Het
Ccser2 G A 14: 36,938,669 T509M probably damaging Het
Crnkl1 A T 2: 145,928,157 Y255* probably null Het
Cyp2d11 C T 15: 82,389,266 S468N possibly damaging Het
Dnah7b C A 1: 46,362,954 T3983N probably benign Het
Ebf1 T A 11: 44,991,522 M427K probably damaging Het
Fxr1 T A 3: 34,061,854 S438T probably damaging Het
Gabrr1 A T 4: 33,157,110 D209V probably damaging Het
Gbx2 G T 1: 89,930,908 probably benign Het
Gm5741 A G 8: 85,067,641 I56T possibly damaging Het
Gm884 T C 11: 103,620,984 M53V unknown Het
Gulo A G 14: 65,991,028 probably null Het
Hhla1 A T 15: 65,936,311 L295* probably null Het
Hmcn1 T A 1: 150,860,341 I126L probably damaging Het
Hpse A G 5: 100,708,771 S121P possibly damaging Het
Inpp5d A G 1: 87,699,729 H321R possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm5b T A 1: 134,609,016 M658K probably damaging Het
Kidins220 A T 12: 25,011,509 E875V probably damaging Het
Nlrp4b A G 7: 10,714,728 E286G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Pde3a A T 6: 141,481,242 I710F probably damaging Het
Phb T C 11: 95,675,268 I126T probably benign Het
Ppp4r1 C T 17: 65,811,346 T164I possibly damaging Het
Psmc1 G A 12: 100,120,103 R333Q probably benign Het
Pygb A G 2: 150,820,775 Y554C probably benign Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Serpina3a A T 12: 104,121,318 M357L possibly damaging Het
Serpinb9e T A 13: 33,260,080 M361K probably benign Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc15a2 G A 16: 36,751,837 Q691* probably null Het
Slc34a2 A G 5: 53,058,181 N9S probably benign Het
Slc4a2 A G 5: 24,435,601 T665A probably damaging Het
Spef2 C A 15: 9,626,034 E1149* probably null Het
Tmem179 A G 12: 112,501,913 W45R probably damaging Het
Tmpo C A 10: 91,163,354 K190N probably damaging Het
Triml1 T C 8: 43,130,283 Y427C probably damaging Het
Trpm2 A G 10: 77,934,724 L720P probably damaging Het
Vmn1r60 A G 7: 5,544,913 Y63H probably benign Het
Vmn2r96 T A 17: 18,597,840 C560S probably damaging Het
Zdhhc13 A G 7: 48,822,730 probably null Het
Other mutations in Slc25a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Slc25a25 APN 2 32419160 missense probably benign 0.04
IGL01431:Slc25a25 APN 2 32419091 missense probably damaging 1.00
IGL02211:Slc25a25 APN 2 32417440 missense probably damaging 1.00
IGL02393:Slc25a25 APN 2 32417843 missense probably benign 0.40
R0385:Slc25a25 UTSW 2 32417822 missense probably damaging 0.99
R1208:Slc25a25 UTSW 2 32417425 missense probably benign 0.11
R1208:Slc25a25 UTSW 2 32417425 missense probably benign 0.11
R1611:Slc25a25 UTSW 2 32420379 missense probably damaging 1.00
R1960:Slc25a25 UTSW 2 32420651 splice site probably null
R3749:Slc25a25 UTSW 2 32420380 missense probably benign 0.21
R4446:Slc25a25 UTSW 2 32430609 missense probably benign 0.00
R4815:Slc25a25 UTSW 2 32420410 missense probably damaging 1.00
R5245:Slc25a25 UTSW 2 32421328 nonsense probably null
R6884:Slc25a25 UTSW 2 32420662 missense probably benign 0.34
X0021:Slc25a25 UTSW 2 32421514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCTATCTATGCTGTCCCC -3'
(R):5'- GTTCTCCAAAACGGCTCCTC -3'

Sequencing Primer
(F):5'- TCTATGCTGTCCCCAAATGGAAGG -3'
(R):5'- TCCTCCCAGGGTAGACTGTG -3'
Posted On2014-11-11