Incidental Mutation 'R2405:Crnkl1'
ID247943
Institutional Source Beutler Lab
Gene Symbol Crnkl1
Ensembl Gene ENSMUSG00000001767
Gene Namecrooked neck pre-mRNA splicing factor 1
Synonyms5730590A01Rik, crn, 1200013P10Rik
MMRRC Submission 040371-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R2405 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location145917479-145935014 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 145928157 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 255 (Y255*)
Ref Sequence ENSEMBL: ENSMUSP00000001818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001818]
Predicted Effect probably null
Transcript: ENSMUST00000001818
AA Change: Y255*
SMART Domains Protein: ENSMUSP00000001818
Gene: ENSMUSG00000001767
AA Change: Y255*

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 30 52 N/A INTRINSIC
HAT 61 93 4.57e-2 SMART
HAT 95 127 3.48e-7 SMART
HAT 129 161 3.33e-4 SMART
HAT 163 194 2.48e-3 SMART
HAT 196 227 1.32e-7 SMART
HAT 229 264 2.11e-6 SMART
HAT 266 300 2.07e0 SMART
Blast:HAT 310 342 1e-13 BLAST
HAT 344 378 3.88e-5 SMART
HAT 388 424 6.86e-6 SMART
HAT 426 457 1.92e2 SMART
HAT 459 491 1.29e-1 SMART
HAT 493 527 2e-7 SMART
HAT 529 560 8.07e-3 SMART
coiled coil region 566 596 N/A INTRINSIC
low complexity region 655 676 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147904
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The crooked neck (crn) gene of Drosophila is essential for embryogenesis and is thought to be involved in cell cycle progression and pre-mRNA splicing. A protein encoded by this human locus has been found to localize to pre-mRNA splicing complexes in the nucleus and is necessary for pre-mRNA splicing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Abl1 T C 2: 31,800,974 L835P possibly damaging Het
Ascc3 T A 10: 50,731,678 V1426D probably damaging Het
Ccny A G 18: 9,353,480 Y98H probably benign Het
Ccser2 G A 14: 36,938,669 T509M probably damaging Het
Cyp2d11 C T 15: 82,389,266 S468N possibly damaging Het
Dnah7b C A 1: 46,362,954 T3983N probably benign Het
Ebf1 T A 11: 44,991,522 M427K probably damaging Het
Fxr1 T A 3: 34,061,854 S438T probably damaging Het
Gabrr1 A T 4: 33,157,110 D209V probably damaging Het
Gbx2 G T 1: 89,930,908 probably benign Het
Gm5741 A G 8: 85,067,641 I56T possibly damaging Het
Gm884 T C 11: 103,620,984 M53V unknown Het
Gulo A G 14: 65,991,028 probably null Het
Hhla1 A T 15: 65,936,311 L295* probably null Het
Hmcn1 T A 1: 150,860,341 I126L probably damaging Het
Hpse A G 5: 100,708,771 S121P possibly damaging Het
Inpp5d A G 1: 87,699,729 H321R possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm5b T A 1: 134,609,016 M658K probably damaging Het
Kidins220 A T 12: 25,011,509 E875V probably damaging Het
Nlrp4b A G 7: 10,714,728 E286G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Pde3a A T 6: 141,481,242 I710F probably damaging Het
Phb T C 11: 95,675,268 I126T probably benign Het
Ppp4r1 C T 17: 65,811,346 T164I possibly damaging Het
Psmc1 G A 12: 100,120,103 R333Q probably benign Het
Pygb A G 2: 150,820,775 Y554C probably benign Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Serpina3a A T 12: 104,121,318 M357L possibly damaging Het
Serpinb9e T A 13: 33,260,080 M361K probably benign Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc15a2 G A 16: 36,751,837 Q691* probably null Het
Slc25a25 C T 2: 32,417,719 probably null Het
Slc34a2 A G 5: 53,058,181 N9S probably benign Het
Slc4a2 A G 5: 24,435,601 T665A probably damaging Het
Spef2 C A 15: 9,626,034 E1149* probably null Het
Tmem179 A G 12: 112,501,913 W45R probably damaging Het
Tmpo C A 10: 91,163,354 K190N probably damaging Het
Triml1 T C 8: 43,130,283 Y427C probably damaging Het
Trpm2 A G 10: 77,934,724 L720P probably damaging Het
Vmn1r60 A G 7: 5,544,913 Y63H probably benign Het
Vmn2r96 T A 17: 18,597,840 C560S probably damaging Het
Zdhhc13 A G 7: 48,822,730 probably null Het
Other mutations in Crnkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Crnkl1 APN 2 145918468 missense possibly damaging 0.75
IGL01092:Crnkl1 APN 2 145919948 missense probably benign 0.00
IGL01643:Crnkl1 APN 2 145931348 missense probably damaging 0.99
IGL01902:Crnkl1 APN 2 145924712 splice site probably null
IGL01908:Crnkl1 APN 2 145928155 missense probably benign 0.01
IGL01934:Crnkl1 APN 2 145931282 missense probably benign 0.02
IGL01947:Crnkl1 APN 2 145921824 missense probably benign 0.05
IGL02342:Crnkl1 APN 2 145924713 critical splice donor site probably null
IGL02721:Crnkl1 APN 2 145923881 missense possibly damaging 0.90
IGL02794:Crnkl1 APN 2 145930612 missense possibly damaging 0.55
IGL02877:Crnkl1 APN 2 145920671 nonsense probably null
IGL03131:Crnkl1 APN 2 145932258 missense probably benign 0.02
R0326:Crnkl1 UTSW 2 145919955 missense probably benign
R1462:Crnkl1 UTSW 2 145921819 missense probably damaging 0.97
R1462:Crnkl1 UTSW 2 145921819 missense probably damaging 0.97
R1471:Crnkl1 UTSW 2 145932316 missense possibly damaging 0.69
R1951:Crnkl1 UTSW 2 145928200 missense probably damaging 0.98
R1952:Crnkl1 UTSW 2 145928200 missense probably damaging 0.98
R1953:Crnkl1 UTSW 2 145928200 missense probably damaging 0.98
R2112:Crnkl1 UTSW 2 145930697 nonsense probably null
R2972:Crnkl1 UTSW 2 145932261 missense probably benign 0.07
R2973:Crnkl1 UTSW 2 145932261 missense probably benign 0.07
R2974:Crnkl1 UTSW 2 145932261 missense probably benign 0.07
R3801:Crnkl1 UTSW 2 145919795 missense probably benign
R3811:Crnkl1 UTSW 2 145931306 missense probably damaging 1.00
R4037:Crnkl1 UTSW 2 145932327 missense possibly damaging 0.82
R4038:Crnkl1 UTSW 2 145932327 missense possibly damaging 0.82
R4039:Crnkl1 UTSW 2 145932327 missense possibly damaging 0.82
R4976:Crnkl1 UTSW 2 145923876 missense possibly damaging 0.86
R5396:Crnkl1 UTSW 2 145928212 missense possibly damaging 0.74
R5868:Crnkl1 UTSW 2 145918553 missense probably benign 0.11
R6245:Crnkl1 UTSW 2 145928131 missense probably benign 0.03
R6564:Crnkl1 UTSW 2 145928245 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ATCACTCAGCTCCAATGTAGAG -3'
(R):5'- TGAACCTTTGGCATGTGCTG -3'

Sequencing Primer
(F):5'- TCCAATGTAGAGCTCAGCAATACATG -3'
(R):5'- AGCCTCAGCCTGTTACTGG -3'
Posted On2014-11-11