Mutagenetix > Incidental Mutations

Incidental Mutation 'R2405:Slc34a2'

247949

Institutional Source

Beutler Lab

Gene Symbol

Slc34a2

Ensembl Gene

ENSMUSG00000029188

Gene Name

solute carrier family 34 (sodium phosphate), member 2

Synonyms

D5Ertd227e, type IIb Na/Picotransporter, Npt2b, NaPi-2b

MMRRC Submission

040371-MU

Accession Numbers

Genbank: NM_011402; MGI: 1342284

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2405 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53038081-53071664 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 53058181 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 9 (N9S)

Ref Sequence

ENSEMBL: ENSMUSP00000130692 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094787] [ENSMUST00000170523]

Predicted Effect

probably benign
Transcript: ENSMUST00000094787
AA Change: N9S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000092380
Gene: ENSMUSG00000029188
AA Change: N9S

Domain	Start	End	E-Value	Type
Pfam:Na_Pi_cotrans	110	252	2.3e-26	PFAM
Pfam:Na_Pi_cotrans	374	551	2.6e-17	PFAM
low complexity region	553	570	N/A	INTRINSIC
low complexity region	616	645	N/A	INTRINSIC
low complexity region	649	655	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147243

Predicted Effect

probably benign
Transcript: ENSMUST00000170523
AA Change: N9S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000130692
Gene: ENSMUSG00000029188
AA Change: N9S

Domain	Start	End	E-Value	Type
Pfam:Na_Pi_cotrans	110	187	2.9e-20	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, embryonic growth arrest, failure of embryo turning and somitogenesis, impaired placental development and impaired yolk sac vascular remodeling. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
9030624J02Rik	G	C	7: 118,792,595	A410P	probably damaging	Het
Abl1	T	C	2: 31,800,974	L835P	possibly damaging	Het
Ascc3	T	A	10: 50,731,678	V1426D	probably damaging	Het
Ccny	A	G	18: 9,353,480	Y98H	probably benign	Het
Ccser2	G	A	14: 36,938,669	T509M	probably damaging	Het
Crnkl1	A	T	2: 145,928,157	Y255*	probably null	Het
Cyp2d11	C	T	15: 82,389,266	S468N	possibly damaging	Het
Dnah7b	C	A	1: 46,362,954	T3983N	probably benign	Het
Ebf1	T	A	11: 44,991,522	M427K	probably damaging	Het
Fxr1	T	A	3: 34,061,854	S438T	probably damaging	Het
Gabrr1	A	T	4: 33,157,110	D209V	probably damaging	Het
Gbx2	G	T	1: 89,930,908		probably benign	Het
Gm5741	A	G	8: 85,067,641	I56T	possibly damaging	Het
Gm884	T	C	11: 103,620,984	M53V	unknown	Het
Gulo	A	G	14: 65,991,028		probably null	Het
Hhla1	A	T	15: 65,936,311	L295*	probably null	Het
Hmcn1	T	A	1: 150,860,341	I126L	probably damaging	Het
Hpse	A	G	5: 100,708,771	S121P	possibly damaging	Het
Inpp5d	A	G	1: 87,699,729	H321R	possibly damaging	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Kdm5b	T	A	1: 134,609,016	M658K	probably damaging	Het
Kidins220	A	T	12: 25,011,509	E875V	probably damaging	Het
Nlrp4b	A	G	7: 10,714,728	E286G	probably benign	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Pde3a	A	T	6: 141,481,242	I710F	probably damaging	Het
Phb	T	C	11: 95,675,268	I126T	probably benign	Het
Ppp4r1	C	T	17: 65,811,346	T164I	possibly damaging	Het
Psmc1	G	A	12: 100,120,103	R333Q	probably benign	Het
Pygb	A	G	2: 150,820,775	Y554C	probably benign	Het
Ror2	G	A	13: 53,130,944	P144L	possibly damaging	Het
Serpina3a	A	T	12: 104,121,318	M357L	possibly damaging	Het
Serpinb9e	T	A	13: 33,260,080	M361K	probably benign	Het
Sgms1	G	A	19: 32,159,672	R165*	probably null	Het
Slc15a2	G	A	16: 36,751,837	Q691*	probably null	Het
Slc25a25	C	T	2: 32,417,719		probably null	Het
Slc4a2	A	G	5: 24,435,601	T665A	probably damaging	Het
Spef2	C	A	15: 9,626,034	E1149*	probably null	Het
Tmem179	A	G	12: 112,501,913	W45R	probably damaging	Het
Tmpo	C	A	10: 91,163,354	K190N	probably damaging	Het
Triml1	T	C	8: 43,130,283	Y427C	probably damaging	Het
Trpm2	A	G	10: 77,934,724	L720P	probably damaging	Het
Vmn1r60	A	G	7: 5,544,913	Y63H	probably benign	Het
Vmn2r96	T	A	17: 18,597,840	C560S	probably damaging	Het
Zdhhc13	A	G	7: 48,822,730		probably null	Het

Other mutations in Slc34a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Slc34a2	APN	5	53065608	missense	probably benign	0.06
IGL00845:Slc34a2	APN	5	53058354	splice site	probably benign
IGL01024:Slc34a2	APN	5	53067630	missense	possibly damaging	0.61
IGL01300:Slc34a2	APN	5	53068127	critical splice acceptor site	probably null
IGL01680:Slc34a2	APN	5	53060876	missense	probably damaging	1.00
IGL02226:Slc34a2	APN	5	53067731	missense	probably benign	0.12
IGL02682:Slc34a2	APN	5	53059238	missense	possibly damaging	0.64
IGL03294:Slc34a2	APN	5	53063998	missense	probably benign	0.00
tucumcari	UTSW	5	53064009	missense	possibly damaging	0.68
D4216:Slc34a2	UTSW	5	53065497	missense	probably benign	0.01
R0094:Slc34a2	UTSW	5	53063968	missense	probably benign	0.28
R0227:Slc34a2	UTSW	5	53069626	missense	possibly damaging	0.51
R0524:Slc34a2	UTSW	5	53064873	nonsense	probably null
R0836:Slc34a2	UTSW	5	53067707	missense	probably benign
R1525:Slc34a2	UTSW	5	53069506	missense	probably benign	0.00
R1655:Slc34a2	UTSW	5	53069419	missense	probably benign	0.00
R1753:Slc34a2	UTSW	5	53061391	missense	probably benign	0.37
R1838:Slc34a2	UTSW	5	53058436	missense	probably benign
R2361:Slc34a2	UTSW	5	53068145	missense	probably benign	0.10
R3688:Slc34a2	UTSW	5	53064832	missense	probably benign	0.06
R4108:Slc34a2	UTSW	5	53064009	missense	possibly damaging	0.68
R4176:Slc34a2	UTSW	5	53067568	missense	probably damaging	1.00
R4380:Slc34a2	UTSW	5	53069286	missense	probably damaging	1.00
R4464:Slc34a2	UTSW	5	53069182	missense	probably damaging	0.99
R4780:Slc34a2	UTSW	5	53069451	missense	probably damaging	1.00
R4816:Slc34a2	UTSW	5	53069020	missense	probably damaging	1.00
R4934:Slc34a2	UTSW	5	53067600	missense	probably damaging	1.00
R5265:Slc34a2	UTSW	5	53061434	missense	probably damaging	0.96
R5309:Slc34a2	UTSW	5	53069488	missense	probably damaging	0.96
R5313:Slc34a2	UTSW	5	53069339	missense	probably damaging	0.96
R5884:Slc34a2	UTSW	5	53069380	missense	possibly damaging	0.46
R6084:Slc34a2	UTSW	5	53067647	missense	possibly damaging	0.91
R6310:Slc34a2	UTSW	5	53064797	critical splice acceptor site	probably null
R6568:Slc34a2	UTSW	5	53069134	missense	probably damaging	1.00
R6817:Slc34a2	UTSW	5	53064028	missense	probably damaging	0.98
R6845:Slc34a2	UTSW	5	53069169	missense	probably damaging	0.96
R6944:Slc34a2	UTSW	5	53064883	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTACAGTTGAACTTGCCCCAG -3'
(R):5'- TACAGGAGTCCCGTTGTCATTTG -3'

Sequencing Primer
(F):5'- TTGAACTTGCCCCAGCGTAG -3'
(R):5'- CCGTTGTCATTTGCTGGAAACAAG -3'

Posted On

2014-11-11