Incidental Mutation 'R2405:Triml1'
ID247958
Institutional Source Beutler Lab
Gene Symbol Triml1
Ensembl Gene ENSMUSG00000031651
Gene Nametripartite motif family-like 1
Synonyms
MMRRC Submission 040371-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R2405 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location43129807-43141486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43130283 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 427 (Y427C)
Ref Sequence ENSEMBL: ENSMUSP00000050267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059692]
Predicted Effect probably damaging
Transcript: ENSMUST00000059692
AA Change: Y427C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050267
Gene: ENSMUSG00000031651
AA Change: Y427C

DomainStartEndE-ValueType
RING 22 62 1.14e-8 SMART
coiled coil region 196 235 N/A INTRINSIC
PRY 291 343 4.64e-23 SMART
Pfam:SPRY 346 462 6.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211541
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tripartite motif family protein with similarities to E3 ubiquitin-protein ligases. While the function of the encoded protein has not been determined, the orthologous protein in mouse has been shown to bind ubiquitin-specific protease 5 and is involved in the blastocyst development stage. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Abl1 T C 2: 31,800,974 L835P possibly damaging Het
Ascc3 T A 10: 50,731,678 V1426D probably damaging Het
Ccny A G 18: 9,353,480 Y98H probably benign Het
Ccser2 G A 14: 36,938,669 T509M probably damaging Het
Crnkl1 A T 2: 145,928,157 Y255* probably null Het
Cyp2d11 C T 15: 82,389,266 S468N possibly damaging Het
Dnah7b C A 1: 46,362,954 T3983N probably benign Het
Ebf1 T A 11: 44,991,522 M427K probably damaging Het
Fxr1 T A 3: 34,061,854 S438T probably damaging Het
Gabrr1 A T 4: 33,157,110 D209V probably damaging Het
Gbx2 G T 1: 89,930,908 probably benign Het
Gm5741 A G 8: 85,067,641 I56T possibly damaging Het
Gm884 T C 11: 103,620,984 M53V unknown Het
Gulo A G 14: 65,991,028 probably null Het
Hhla1 A T 15: 65,936,311 L295* probably null Het
Hmcn1 T A 1: 150,860,341 I126L probably damaging Het
Hpse A G 5: 100,708,771 S121P possibly damaging Het
Inpp5d A G 1: 87,699,729 H321R possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm5b T A 1: 134,609,016 M658K probably damaging Het
Kidins220 A T 12: 25,011,509 E875V probably damaging Het
Nlrp4b A G 7: 10,714,728 E286G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Pde3a A T 6: 141,481,242 I710F probably damaging Het
Phb T C 11: 95,675,268 I126T probably benign Het
Ppp4r1 C T 17: 65,811,346 T164I possibly damaging Het
Psmc1 G A 12: 100,120,103 R333Q probably benign Het
Pygb A G 2: 150,820,775 Y554C probably benign Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Serpina3a A T 12: 104,121,318 M357L possibly damaging Het
Serpinb9e T A 13: 33,260,080 M361K probably benign Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc15a2 G A 16: 36,751,837 Q691* probably null Het
Slc25a25 C T 2: 32,417,719 probably null Het
Slc34a2 A G 5: 53,058,181 N9S probably benign Het
Slc4a2 A G 5: 24,435,601 T665A probably damaging Het
Spef2 C A 15: 9,626,034 E1149* probably null Het
Tmem179 A G 12: 112,501,913 W45R probably damaging Het
Tmpo C A 10: 91,163,354 K190N probably damaging Het
Trpm2 A G 10: 77,934,724 L720P probably damaging Het
Vmn1r60 A G 7: 5,544,913 Y63H probably benign Het
Vmn2r96 T A 17: 18,597,840 C560S probably damaging Het
Zdhhc13 A G 7: 48,822,730 probably null Het
Other mutations in Triml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Triml1 APN 8 43140961 splice site probably benign
IGL00920:Triml1 APN 8 43138682 missense probably damaging 1.00
IGL01319:Triml1 APN 8 43141397 utr 5 prime probably benign
IGL01323:Triml1 APN 8 43138563 splice site probably null
IGL01998:Triml1 APN 8 43141313 missense probably damaging 1.00
IGL02394:Triml1 APN 8 43138592 missense possibly damaging 0.57
R0359:Triml1 UTSW 8 43130505 missense probably damaging 1.00
R0400:Triml1 UTSW 8 43141040 missense probably benign 0.03
R1799:Triml1 UTSW 8 43130475 missense probably damaging 1.00
R2008:Triml1 UTSW 8 43130605 missense probably damaging 0.97
R2363:Triml1 UTSW 8 43141371 missense probably damaging 0.99
R5333:Triml1 UTSW 8 43130290 missense possibly damaging 0.82
R6093:Triml1 UTSW 8 43140718 missense probably benign 0.04
R6244:Triml1 UTSW 8 43138756 nonsense probably null
R6808:Triml1 UTSW 8 43141221 missense probably damaging 0.99
R6860:Triml1 UTSW 8 43130566 missense probably damaging 1.00
Z1088:Triml1 UTSW 8 43130398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTTGTCTTTGCTCAAG -3'
(R):5'- AGCTCAGATCTTCACCTGCG -3'

Sequencing Primer
(F):5'- TCTTTGCTCAAGGCTCAGGGC -3'
(R):5'- TCTGCAAGGACTCTGTGAAC -3'
Posted On2014-11-11