Incidental Mutation 'R2405:Trpm2'
ID247963
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Nametransient receptor potential cation channel, subfamily M, member 2
SynonymsLTRPC2, 9830168K16Rik, TRPC7, Trrp7
MMRRC Submission 040371-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R2405 (G1)
Quality Score170
Status Not validated
Chromosome10
Chromosomal Location77907722-77970563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77934724 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 720 (L720P)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105400
Predicted Effect probably damaging
Transcript: ENSMUST00000105401
AA Change: L720P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: L720P

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153842
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Abl1 T C 2: 31,800,974 L835P possibly damaging Het
Ascc3 T A 10: 50,731,678 V1426D probably damaging Het
Ccny A G 18: 9,353,480 Y98H probably benign Het
Ccser2 G A 14: 36,938,669 T509M probably damaging Het
Crnkl1 A T 2: 145,928,157 Y255* probably null Het
Cyp2d11 C T 15: 82,389,266 S468N possibly damaging Het
Dnah7b C A 1: 46,362,954 T3983N probably benign Het
Ebf1 T A 11: 44,991,522 M427K probably damaging Het
Fxr1 T A 3: 34,061,854 S438T probably damaging Het
Gabrr1 A T 4: 33,157,110 D209V probably damaging Het
Gbx2 G T 1: 89,930,908 probably benign Het
Gm5741 A G 8: 85,067,641 I56T possibly damaging Het
Gm884 T C 11: 103,620,984 M53V unknown Het
Gulo A G 14: 65,991,028 probably null Het
Hhla1 A T 15: 65,936,311 L295* probably null Het
Hmcn1 T A 1: 150,860,341 I126L probably damaging Het
Hpse A G 5: 100,708,771 S121P possibly damaging Het
Inpp5d A G 1: 87,699,729 H321R possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm5b T A 1: 134,609,016 M658K probably damaging Het
Kidins220 A T 12: 25,011,509 E875V probably damaging Het
Nlrp4b A G 7: 10,714,728 E286G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Pde3a A T 6: 141,481,242 I710F probably damaging Het
Phb T C 11: 95,675,268 I126T probably benign Het
Ppp4r1 C T 17: 65,811,346 T164I possibly damaging Het
Psmc1 G A 12: 100,120,103 R333Q probably benign Het
Pygb A G 2: 150,820,775 Y554C probably benign Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Serpina3a A T 12: 104,121,318 M357L possibly damaging Het
Serpinb9e T A 13: 33,260,080 M361K probably benign Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc15a2 G A 16: 36,751,837 Q691* probably null Het
Slc25a25 C T 2: 32,417,719 probably null Het
Slc34a2 A G 5: 53,058,181 N9S probably benign Het
Slc4a2 A G 5: 24,435,601 T665A probably damaging Het
Spef2 C A 15: 9,626,034 E1149* probably null Het
Tmem179 A G 12: 112,501,913 W45R probably damaging Het
Tmpo C A 10: 91,163,354 K190N probably damaging Het
Triml1 T C 8: 43,130,283 Y427C probably damaging Het
Vmn1r60 A G 7: 5,544,913 Y63H probably benign Het
Vmn2r96 T A 17: 18,597,840 C560S probably damaging Het
Zdhhc13 A G 7: 48,822,730 probably null Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77942915 splice site probably null
IGL00773:Trpm2 APN 10 77949214 nonsense probably null
IGL00962:Trpm2 APN 10 77943916 splice site probably benign
IGL01093:Trpm2 APN 10 77932280 missense probably benign 0.04
IGL01124:Trpm2 APN 10 77945825 splice site probably benign
IGL01301:Trpm2 APN 10 77923984 missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77942996 nonsense probably null
IGL02175:Trpm2 APN 10 77937907 missense probably benign 0.07
IGL02653:Trpm2 APN 10 77912669 missense probably benign 0.19
IGL02667:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77918986 missense probably benign 0.16
IGL02951:Trpm2 APN 10 77929278 missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77918909 missense probably benign 0.18
IGL03242:Trpm2 APN 10 77917734 missense probably benign
IGL03405:Trpm2 APN 10 77966072 splice site probably benign
ANU18:Trpm2 UTSW 10 77923984 missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77943990 splice site probably benign
R0332:Trpm2 UTSW 10 77947988 missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77923516 missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77929288 missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77923564 missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77966994 nonsense probably null
R1518:Trpm2 UTSW 10 77943005 missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77942999 missense probably benign 0.14
R1593:Trpm2 UTSW 10 77943076 missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77935875 splice site probably null
R1673:Trpm2 UTSW 10 77942944 missense probably benign
R1912:Trpm2 UTSW 10 77945876 missense probably benign 0.10
R1932:Trpm2 UTSW 10 77941158 missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77947989 missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77925766 missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R2201:Trpm2 UTSW 10 77920471 nonsense probably null
R2217:Trpm2 UTSW 10 77941182 missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77918964 missense probably benign 0.04
R2339:Trpm2 UTSW 10 77914806 splice site probably benign
R2395:Trpm2 UTSW 10 77947880 missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77930637 missense probably benign 0.14
R2567:Trpm2 UTSW 10 77941174 missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3002:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3125:Trpm2 UTSW 10 77911374 missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77932302 missense probably benign 0.03
R3777:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R3778:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R4272:Trpm2 UTSW 10 77933642 missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77917725 missense probably benign 0.44
R4395:Trpm2 UTSW 10 77929219 missense probably benign 0.01
R4423:Trpm2 UTSW 10 77935068 missense probably benign 0.00
R4452:Trpm2 UTSW 10 77923593 missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77945916 missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77938138 missense probably benign 0.05
R4825:Trpm2 UTSW 10 77941173 missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77932189 nonsense probably null
R4943:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77917792 missense probably benign 0.34
R5046:Trpm2 UTSW 10 77966018 missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77923521 missense probably benign 0.06
R5523:Trpm2 UTSW 10 77935961 missense probably benign 0.04
R5562:Trpm2 UTSW 10 77959939 missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77932139 missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77912636 missense probably benign 0.00
R5633:Trpm2 UTSW 10 77938353 missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77965980 missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77959900 missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77917713 missense probably benign 0.00
R6075:Trpm2 UTSW 10 77935043 critical splice donor site probably null
R6092:Trpm2 UTSW 10 77925682 missense probably benign 0.30
R6309:Trpm2 UTSW 10 77938368 missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77932227 missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6579:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6640:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6642:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6798:Trpm2 UTSW 10 77914740 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTTGCCCATTGCCAAACC -3'
(R):5'- CTGCCTTTGCTGCGGATATC -3'

Sequencing Primer
(F):5'- ATCCATCTGCCTATGGTGAAG -3'
(R):5'- CTGCGGATATCACTTGAAGGGC -3'
Posted On2014-11-11