Incidental Mutation 'R2405:Nsf'
ID247969
Institutional Source Beutler Lab
Gene Symbol Nsf
Ensembl Gene ENSMUSG00000034187
Gene NameN-ethylmaleimide sensitive fusion protein
SynonymsSKD2, N-ethylmaleimide sensitive factor
MMRRC Submission 040371-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R2405 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location103821782-103954056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103930752 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 26 (E26K)
Ref Sequence ENSEMBL: ENSMUSP00000099364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103075] [ENSMUST00000133774] [ENSMUST00000149642]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103075
AA Change: E26K

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099364
Gene: ENSMUSG00000034187
AA Change: E26K

DomainStartEndE-ValueType
CDC48_N 5 86 2.7e-16 SMART
CDC48_2 111 183 6.22e-7 SMART
AAA 252 399 3.65e-19 SMART
AAA 535 671 2.2e-13 SMART
low complexity region 674 683 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107009
Predicted Effect probably benign
Transcript: ENSMUST00000133774
SMART Domains Protein: ENSMUSP00000133591
Gene: ENSMUSG00000034187

DomainStartEndE-ValueType
Pfam:CDC48_N 1 51 1.5e-10 PFAM
CDC48_2 76 148 6.22e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145126
Predicted Effect possibly damaging
Transcript: ENSMUST00000149642
AA Change: E23K

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133603
Gene: ENSMUSG00000034187
AA Change: E23K

DomainStartEndE-ValueType
CDC48_N 2 76 6.51e-10 SMART
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Abl1 T C 2: 31,800,974 L835P possibly damaging Het
Ascc3 T A 10: 50,731,678 V1426D probably damaging Het
Ccny A G 18: 9,353,480 Y98H probably benign Het
Ccser2 G A 14: 36,938,669 T509M probably damaging Het
Crnkl1 A T 2: 145,928,157 Y255* probably null Het
Cyp2d11 C T 15: 82,389,266 S468N possibly damaging Het
Dnah7b C A 1: 46,362,954 T3983N probably benign Het
Ebf1 T A 11: 44,991,522 M427K probably damaging Het
Fxr1 T A 3: 34,061,854 S438T probably damaging Het
Gabrr1 A T 4: 33,157,110 D209V probably damaging Het
Gbx2 G T 1: 89,930,908 probably benign Het
Gm5741 A G 8: 85,067,641 I56T possibly damaging Het
Gm884 T C 11: 103,620,984 M53V unknown Het
Gulo A G 14: 65,991,028 probably null Het
Hhla1 A T 15: 65,936,311 L295* probably null Het
Hmcn1 T A 1: 150,860,341 I126L probably damaging Het
Hpse A G 5: 100,708,771 S121P possibly damaging Het
Inpp5d A G 1: 87,699,729 H321R possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm5b T A 1: 134,609,016 M658K probably damaging Het
Kidins220 A T 12: 25,011,509 E875V probably damaging Het
Nlrp4b A G 7: 10,714,728 E286G probably benign Het
Pde3a A T 6: 141,481,242 I710F probably damaging Het
Phb T C 11: 95,675,268 I126T probably benign Het
Ppp4r1 C T 17: 65,811,346 T164I possibly damaging Het
Psmc1 G A 12: 100,120,103 R333Q probably benign Het
Pygb A G 2: 150,820,775 Y554C probably benign Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Serpina3a A T 12: 104,121,318 M357L possibly damaging Het
Serpinb9e T A 13: 33,260,080 M361K probably benign Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc15a2 G A 16: 36,751,837 Q691* probably null Het
Slc25a25 C T 2: 32,417,719 probably null Het
Slc34a2 A G 5: 53,058,181 N9S probably benign Het
Slc4a2 A G 5: 24,435,601 T665A probably damaging Het
Spef2 C A 15: 9,626,034 E1149* probably null Het
Tmem179 A G 12: 112,501,913 W45R probably damaging Het
Tmpo C A 10: 91,163,354 K190N probably damaging Het
Triml1 T C 8: 43,130,283 Y427C probably damaging Het
Trpm2 A G 10: 77,934,724 L720P probably damaging Het
Vmn1r60 A G 7: 5,544,913 Y63H probably benign Het
Vmn2r96 T A 17: 18,597,840 C560S probably damaging Het
Zdhhc13 A G 7: 48,822,730 probably null Het
Other mutations in Nsf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Nsf APN 11 103861885 splice site probably benign
IGL01377:Nsf APN 11 103872647 missense probably damaging 0.97
IGL01994:Nsf APN 11 103928782 missense probably damaging 0.98
IGL02141:Nsf APN 11 103828525 missense probably benign 0.02
IGL02663:Nsf APN 11 103930815 missense probably benign 0.04
IGL02871:Nsf APN 11 103862056 splice site probably benign
uhaul UTSW 11 103930752 missense possibly damaging 0.59
R0180:Nsf UTSW 11 103930780 missense probably damaging 1.00
R0880:Nsf UTSW 11 103913372 missense possibly damaging 0.72
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1203:Nsf UTSW 11 103926126 unclassified probably benign
R1873:Nsf UTSW 11 103859017 missense probably damaging 1.00
R1951:Nsf UTSW 11 103882876 nonsense probably null
R2163:Nsf UTSW 11 103863333 missense possibly damaging 0.64
R2193:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2194:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2287:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2289:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2343:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2345:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2346:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2347:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2350:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2406:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2407:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2408:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2409:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2411:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2435:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2924:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2925:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2987:Nsf UTSW 11 103859043 splice site probably null
R3177:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3277:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3741:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3742:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3845:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R4278:Nsf UTSW 11 103930806 missense probably damaging 0.96
R4717:Nsf UTSW 11 103823769 missense probably damaging 1.00
R4775:Nsf UTSW 11 103872593 missense possibly damaging 0.93
R4915:Nsf UTSW 11 103910359 unclassified probably benign
R4918:Nsf UTSW 11 103910359 unclassified probably benign
R5090:Nsf UTSW 11 103910578 missense probably benign 0.00
R5126:Nsf UTSW 11 103882792 nonsense probably null
R5411:Nsf UTSW 11 103882811 missense probably damaging 1.00
R5560:Nsf UTSW 11 103863255 missense possibly damaging 0.47
R6344:Nsf UTSW 11 103861904 missense probably damaging 1.00
R6596:Nsf UTSW 11 103910457 missense probably damaging 0.98
X0066:Nsf UTSW 11 103823740 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAAGGTTTGACAGTGTAATGACAG -3'
(R):5'- CTACCCTGGAGGAAGAAACACG -3'

Sequencing Primer
(F):5'- GTTTGACAGTGTAATGACAGAAATGC -3'
(R):5'- TCAGGATGGAGGGACATTTACTAC -3'
Posted On2014-11-11