Incidental Mutation 'R2405:Serpinb9e'
ID247975
Institutional Source Beutler Lab
Gene Symbol Serpinb9e
Ensembl Gene ENSMUSG00000062342
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9e
SynonymsSpi14, ovalbumin, NK26
MMRRC Submission 040371-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2405 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location33249612-33260850 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33260080 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 361 (M361K)
Ref Sequence ENSEMBL: ENSMUSP00000071769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071873]
Predicted Effect probably benign
Transcript: ENSMUST00000071873
AA Change: M361K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071769
Gene: ENSMUSG00000062342
AA Change: M361K

DomainStartEndE-ValueType
SERPIN 13 377 1.82e-168 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Abl1 T C 2: 31,800,974 L835P possibly damaging Het
Ascc3 T A 10: 50,731,678 V1426D probably damaging Het
Ccny A G 18: 9,353,480 Y98H probably benign Het
Ccser2 G A 14: 36,938,669 T509M probably damaging Het
Crnkl1 A T 2: 145,928,157 Y255* probably null Het
Cyp2d11 C T 15: 82,389,266 S468N possibly damaging Het
Dnah7b C A 1: 46,362,954 T3983N probably benign Het
Ebf1 T A 11: 44,991,522 M427K probably damaging Het
Fxr1 T A 3: 34,061,854 S438T probably damaging Het
Gabrr1 A T 4: 33,157,110 D209V probably damaging Het
Gbx2 G T 1: 89,930,908 probably benign Het
Gm5741 A G 8: 85,067,641 I56T possibly damaging Het
Gm884 T C 11: 103,620,984 M53V unknown Het
Gulo A G 14: 65,991,028 probably null Het
Hhla1 A T 15: 65,936,311 L295* probably null Het
Hmcn1 T A 1: 150,860,341 I126L probably damaging Het
Hpse A G 5: 100,708,771 S121P possibly damaging Het
Inpp5d A G 1: 87,699,729 H321R possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm5b T A 1: 134,609,016 M658K probably damaging Het
Kidins220 A T 12: 25,011,509 E875V probably damaging Het
Nlrp4b A G 7: 10,714,728 E286G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Pde3a A T 6: 141,481,242 I710F probably damaging Het
Phb T C 11: 95,675,268 I126T probably benign Het
Ppp4r1 C T 17: 65,811,346 T164I possibly damaging Het
Psmc1 G A 12: 100,120,103 R333Q probably benign Het
Pygb A G 2: 150,820,775 Y554C probably benign Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Serpina3a A T 12: 104,121,318 M357L possibly damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc15a2 G A 16: 36,751,837 Q691* probably null Het
Slc25a25 C T 2: 32,417,719 probably null Het
Slc34a2 A G 5: 53,058,181 N9S probably benign Het
Slc4a2 A G 5: 24,435,601 T665A probably damaging Het
Spef2 C A 15: 9,626,034 E1149* probably null Het
Tmem179 A G 12: 112,501,913 W45R probably damaging Het
Tmpo C A 10: 91,163,354 K190N probably damaging Het
Triml1 T C 8: 43,130,283 Y427C probably damaging Het
Trpm2 A G 10: 77,934,724 L720P probably damaging Het
Vmn1r60 A G 7: 5,544,913 Y63H probably benign Het
Vmn2r96 T A 17: 18,597,840 C560S probably damaging Het
Zdhhc13 A G 7: 48,822,730 probably null Het
Other mutations in Serpinb9e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Serpinb9e APN 13 33255125 missense probably damaging 0.97
IGL02352:Serpinb9e APN 13 33257820 splice site probably benign
IGL02359:Serpinb9e APN 13 33257820 splice site probably benign
IGL02604:Serpinb9e APN 13 33257759 missense probably benign 0.00
IGL02859:Serpinb9e APN 13 33251650 missense possibly damaging 0.83
R0257:Serpinb9e UTSW 13 33257681 missense probably benign 0.24
R0751:Serpinb9e UTSW 13 33259774 missense probably benign 0.00
R1101:Serpinb9e UTSW 13 33260088 missense probably benign 0.10
R1170:Serpinb9e UTSW 13 33257752 nonsense probably null
R1184:Serpinb9e UTSW 13 33259774 missense probably benign 0.00
R1253:Serpinb9e UTSW 13 33255119 missense possibly damaging 0.77
R1405:Serpinb9e UTSW 13 33260026 missense probably benign
R1405:Serpinb9e UTSW 13 33260026 missense probably benign
R1463:Serpinb9e UTSW 13 33255116 missense probably benign
R1566:Serpinb9e UTSW 13 33253494 missense probably damaging 1.00
R1924:Serpinb9e UTSW 13 33253445 missense probably benign 0.07
R1964:Serpinb9e UTSW 13 33253491 missense probably benign 0.04
R2153:Serpinb9e UTSW 13 33252978 missense probably damaging 1.00
R2972:Serpinb9e UTSW 13 33255143 missense probably benign
R2973:Serpinb9e UTSW 13 33255143 missense probably benign
R2974:Serpinb9e UTSW 13 33255143 missense probably benign
R3854:Serpinb9e UTSW 13 33255154 missense probably benign 0.40
R4173:Serpinb9e UTSW 13 33255158 missense probably damaging 0.97
R4937:Serpinb9e UTSW 13 33252952 missense probably benign 0.11
R4949:Serpinb9e UTSW 13 33251608 missense possibly damaging 0.81
R5347:Serpinb9e UTSW 13 33257784 missense probably damaging 1.00
R5976:Serpinb9e UTSW 13 33255129 missense probably benign
R5979:Serpinb9e UTSW 13 33255053 missense probably benign 0.18
R5991:Serpinb9e UTSW 13 33259807 missense probably damaging 1.00
R6059:Serpinb9e UTSW 13 33257774 missense probably benign 0.29
R6884:Serpinb9e UTSW 13 33251626 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AATGGAAGCAAAGCTGACTTCTCAG -3'
(R):5'- GAGCTGAATGTGGGCATCAC -3'

Sequencing Primer
(F):5'- GCAAAGCTGACTTCTCAGGAATGTC -3'
(R):5'- CTGAATGTGGGCATCACTAGATC -3'
Posted On2014-11-11