Mutagenetix > Incidental Mutations

Incidental Mutation 'R2405:Vmn2r96'

247986

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r96

Ensembl Gene

ENSMUSG00000091679

Gene Name

vomeronasal 2, receptor 96

Synonyms

EG433070

MMRRC Submission

040371-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.472) question?

Stock #

R2405 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18573151-18616003 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 18597840 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 560 (C560S)

Ref Sequence

ENSEMBL: ENSMUSP00000131564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165692] [ENSMUST00000177244] [ENSMUST00000231261] [ENSMUST00000231286]

Predicted Effect

probably damaging
Transcript: ENSMUST00000165692
AA Change: C560S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000131564
Gene: ENSMUSG00000091679
AA Change: C560S

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	1	257	8.6e-20	PFAM
Pfam:NCD3G	317	370	3.7e-22	PFAM
Pfam:7tm_3	402	638	3.9e-53	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177244
AA Change: C752S

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000135095
Gene: ENSMUSG00000091679
AA Change: C752S

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	1	245	4.2e-19	PFAM
Pfam:NCD3G	317	370	6.9e-21	PFAM
Pfam:7tm_3	400	639	3.4e-75	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000231261

Predicted Effect

probably benign
Transcript: ENSMUST00000231286
AA Change: C752S

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
9030624J02Rik	G	C	7: 118,792,595	A410P	probably damaging	Het
Abl1	T	C	2: 31,800,974	L835P	possibly damaging	Het
Ascc3	T	A	10: 50,731,678	V1426D	probably damaging	Het
Ccny	A	G	18: 9,353,480	Y98H	probably benign	Het
Ccser2	G	A	14: 36,938,669	T509M	probably damaging	Het
Crnkl1	A	T	2: 145,928,157	Y255*	probably null	Het
Cyp2d11	C	T	15: 82,389,266	S468N	possibly damaging	Het
Dnah7b	C	A	1: 46,362,954	T3983N	probably benign	Het
Ebf1	T	A	11: 44,991,522	M427K	probably damaging	Het
Fxr1	T	A	3: 34,061,854	S438T	probably damaging	Het
Gabrr1	A	T	4: 33,157,110	D209V	probably damaging	Het
Gbx2	G	T	1: 89,930,908		probably benign	Het
Gm5741	A	G	8: 85,067,641	I56T	possibly damaging	Het
Gm884	T	C	11: 103,620,984	M53V	unknown	Het
Gulo	A	G	14: 65,991,028		probably null	Het
Hhla1	A	T	15: 65,936,311	L295*	probably null	Het
Hmcn1	T	A	1: 150,860,341	I126L	probably damaging	Het
Hpse	A	G	5: 100,708,771	S121P	possibly damaging	Het
Inpp5d	A	G	1: 87,699,729	H321R	possibly damaging	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Kdm5b	T	A	1: 134,609,016	M658K	probably damaging	Het
Kidins220	A	T	12: 25,011,509	E875V	probably damaging	Het
Nlrp4b	A	G	7: 10,714,728	E286G	probably benign	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Pde3a	A	T	6: 141,481,242	I710F	probably damaging	Het
Phb	T	C	11: 95,675,268	I126T	probably benign	Het
Ppp4r1	C	T	17: 65,811,346	T164I	possibly damaging	Het
Psmc1	G	A	12: 100,120,103	R333Q	probably benign	Het
Pygb	A	G	2: 150,820,775	Y554C	probably benign	Het
Ror2	G	A	13: 53,130,944	P144L	possibly damaging	Het
Serpina3a	A	T	12: 104,121,318	M357L	possibly damaging	Het
Serpinb9e	T	A	13: 33,260,080	M361K	probably benign	Het
Sgms1	G	A	19: 32,159,672	R165*	probably null	Het
Slc15a2	G	A	16: 36,751,837	Q691*	probably null	Het
Slc25a25	C	T	2: 32,417,719		probably null	Het
Slc34a2	A	G	5: 53,058,181	N9S	probably benign	Het
Slc4a2	A	G	5: 24,435,601	T665A	probably damaging	Het
Spef2	C	A	15: 9,626,034	E1149*	probably null	Het
Tmem179	A	G	12: 112,501,913	W45R	probably damaging	Het
Tmpo	C	A	10: 91,163,354	K190N	probably damaging	Het
Triml1	T	C	8: 43,130,283	Y427C	probably damaging	Het
Trpm2	A	G	10: 77,934,724	L720P	probably damaging	Het
Vmn1r60	A	G	7: 5,544,913	Y63H	probably benign	Het
Zdhhc13	A	G	7: 48,822,730		probably null	Het

Other mutations in Vmn2r96

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Vmn2r96	APN	17	18583815	missense	probably benign	0.00
IGL00563:Vmn2r96	APN	17	18583815	missense	probably benign	0.00
IGL00769:Vmn2r96	APN	17	18583819	missense	probably benign	0.00
IGL01314:Vmn2r96	APN	17	18582964	missense	probably benign	0.00
IGL01983:Vmn2r96	APN	17	18597265	missense	probably damaging	0.99
IGL02314:Vmn2r96	APN	17	18583959	missense	probably benign	0.01
IGL02600:Vmn2r96	APN	17	18597567	missense	probably benign
IGL02672:Vmn2r96	APN	17	18598114	missense	probably benign	0.02
IGL02750:Vmn2r96	APN	17	18582589	missense	probably benign	0.01
IGL03068:Vmn2r96	APN	17	18582875	missense	probably benign	0.00
IGL03411:Vmn2r96	APN	17	18586372	missense	possibly damaging	0.88
R0316:Vmn2r96	UTSW	17	18582565	missense	probably damaging	1.00
R0502:Vmn2r96	UTSW	17	18584000	missense	probably benign
R0580:Vmn2r96	UTSW	17	18582638	missense	probably damaging	1.00
R0652:Vmn2r96	UTSW	17	18597568	missense	probably benign	0.05
R0789:Vmn2r96	UTSW	17	18582476	missense	possibly damaging	0.81
R1462:Vmn2r96	UTSW	17	18597398	missense	possibly damaging	0.94
R1462:Vmn2r96	UTSW	17	18597398	missense	possibly damaging	0.94
R1660:Vmn2r96	UTSW	17	18597726	missense	probably benign	0.00
R1755:Vmn2r96	UTSW	17	18582653	missense	possibly damaging	0.50
R1843:Vmn2r96	UTSW	17	18597921	missense	probably benign	0.14
R1943:Vmn2r96	UTSW	17	18586402	missense	probably benign	0.09
R1993:Vmn2r96	UTSW	17	18583876	missense	probably damaging	1.00
R2018:Vmn2r96	UTSW	17	18584001	missense	probably benign
R3977:Vmn2r96	UTSW	17	18597679	missense	probably damaging	1.00
R3979:Vmn2r96	UTSW	17	18597679	missense	probably damaging	1.00
R4059:Vmn2r96	UTSW	17	18598077	missense	probably benign	0.20
R4693:Vmn2r96	UTSW	17	18583008	missense	probably benign	0.03
R4709:Vmn2r96	UTSW	17	18582826	missense	probably benign	0.36
R4776:Vmn2r96	UTSW	17	18597508	missense	probably damaging	1.00
R4882:Vmn2r96	UTSW	17	18597604	missense	probably damaging	1.00
R4920:Vmn2r96	UTSW	17	18582656	missense	probably benign	0.07
R5143:Vmn2r96	UTSW	17	18583858	missense	possibly damaging	0.65
R5301:Vmn2r96	UTSW	17	18597688	missense	probably damaging	0.98
R5507:Vmn2r96	UTSW	17	18597829	missense	probably damaging	1.00
R6151:Vmn2r96	UTSW	17	18583959	missense	probably benign	0.01
R6181:Vmn2r96	UTSW	17	18583864	missense	probably benign
R6339:Vmn2r96	UTSW	17	18583862	missense	possibly damaging	0.84
R6404:Vmn2r96	UTSW	17	18597531	missense	probably damaging	1.00
R6452:Vmn2r96	UTSW	17	18583855	missense	probably benign	0.07
R6749:Vmn2r96	UTSW	17	18598090	missense	probably damaging	0.99
R6813:Vmn2r96	UTSW	17	18581854	missense	probably benign	0.04
R6851:Vmn2r96	UTSW	17	18582538	missense	possibly damaging	0.95
R6944:Vmn2r96	UTSW	17	18597629	missense	probably benign	0.16
R6949:Vmn2r96	UTSW	17	18597838	missense	probably damaging	1.00
R6962:Vmn2r96	UTSW	17	18598021	missense	probably damaging	0.99
R6990:Vmn2r96	UTSW	17	18583820	missense	probably benign
Z1088:Vmn2r96	UTSW	17	18597366	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- GGGTCCGAACTACATCATTCC -3'
(R):5'- ACTTGGGACCGAATATGAAGGC -3'

Sequencing Primer
(F):5'- GGTCCGAACTACATCATTCCTATCTG -3'
(R):5'- GATAGAGAATACTTCCATGGCTACC -3'

Posted On

2014-11-11