Incidental Mutation 'R2405:Ppp4r1'
ID247987
Institutional Source Beutler Lab
Gene Symbol Ppp4r1
Ensembl Gene ENSMUSG00000061950
Gene Nameprotein phosphatase 4, regulatory subunit 1
SynonymsPp4r1, 3110001J10Rik
MMRRC Submission 040371-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R2405 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location65782573-65841926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65811346 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 164 (T164I)
Ref Sequence ENSEMBL: ENSMUSP00000124690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073104] [ENSMUST00000160664] [ENSMUST00000161127] [ENSMUST00000162109] [ENSMUST00000162272]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073104
AA Change: T181I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072848
Gene: ENSMUSG00000061950
AA Change: T181I

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
Pfam:HEAT 213 244 2e-5 PFAM
Pfam:HEAT 253 280 2.7e-6 PFAM
low complexity region 531 540 N/A INTRINSIC
PDB:3FGA|A 664 930 3e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000160664
AA Change: T164I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124690
Gene: ENSMUSG00000061950
AA Change: T164I

DomainStartEndE-ValueType
low complexity region 135 146 N/A INTRINSIC
Pfam:HEAT 236 263 2.2e-6 PFAM
low complexity region 514 523 N/A INTRINSIC
PDB:3FGA|A 647 913 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000161127
AA Change: T138I

PolyPhen 2 Score 0.245 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123862
Gene: ENSMUSG00000061950
AA Change: T138I

DomainStartEndE-ValueType
SCOP:d1gw5a_ 25 154 1e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162109
AA Change: T181I

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125220
Gene: ENSMUSG00000061950
AA Change: T181I

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
Pfam:HEAT 253 280 7.1e-7 PFAM
Pfam:HEAT 292 322 2.1e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162272
AA Change: T138I

PolyPhen 2 Score 0.245 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124227
Gene: ENSMUSG00000061950
AA Change: T138I

DomainStartEndE-ValueType
SCOP:d1gw5a_ 57 220 3e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162788
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several alternate regulatory subunits of serine/threonine protein phosphatase 4 (PP4). The protein features multiple HEAT repeats. This protein forms a complex with PP4RC. This complex may have a distinct role from other PP4 complexes, including regulation of HDAC3 (Zhang et al., PMID: 15805470). There is also a transcribed pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Abl1 T C 2: 31,800,974 L835P possibly damaging Het
Ascc3 T A 10: 50,731,678 V1426D probably damaging Het
Ccny A G 18: 9,353,480 Y98H probably benign Het
Ccser2 G A 14: 36,938,669 T509M probably damaging Het
Crnkl1 A T 2: 145,928,157 Y255* probably null Het
Cyp2d11 C T 15: 82,389,266 S468N possibly damaging Het
Dnah7b C A 1: 46,362,954 T3983N probably benign Het
Ebf1 T A 11: 44,991,522 M427K probably damaging Het
Fxr1 T A 3: 34,061,854 S438T probably damaging Het
Gabrr1 A T 4: 33,157,110 D209V probably damaging Het
Gbx2 G T 1: 89,930,908 probably benign Het
Gm5741 A G 8: 85,067,641 I56T possibly damaging Het
Gm884 T C 11: 103,620,984 M53V unknown Het
Gulo A G 14: 65,991,028 probably null Het
Hhla1 A T 15: 65,936,311 L295* probably null Het
Hmcn1 T A 1: 150,860,341 I126L probably damaging Het
Hpse A G 5: 100,708,771 S121P possibly damaging Het
Inpp5d A G 1: 87,699,729 H321R possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm5b T A 1: 134,609,016 M658K probably damaging Het
Kidins220 A T 12: 25,011,509 E875V probably damaging Het
Nlrp4b A G 7: 10,714,728 E286G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Pde3a A T 6: 141,481,242 I710F probably damaging Het
Phb T C 11: 95,675,268 I126T probably benign Het
Psmc1 G A 12: 100,120,103 R333Q probably benign Het
Pygb A G 2: 150,820,775 Y554C probably benign Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Serpina3a A T 12: 104,121,318 M357L possibly damaging Het
Serpinb9e T A 13: 33,260,080 M361K probably benign Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc15a2 G A 16: 36,751,837 Q691* probably null Het
Slc25a25 C T 2: 32,417,719 probably null Het
Slc34a2 A G 5: 53,058,181 N9S probably benign Het
Slc4a2 A G 5: 24,435,601 T665A probably damaging Het
Spef2 C A 15: 9,626,034 E1149* probably null Het
Tmem179 A G 12: 112,501,913 W45R probably damaging Het
Tmpo C A 10: 91,163,354 K190N probably damaging Het
Triml1 T C 8: 43,130,283 Y427C probably damaging Het
Trpm2 A G 10: 77,934,724 L720P probably damaging Het
Vmn1r60 A G 7: 5,544,913 Y63H probably benign Het
Vmn2r96 T A 17: 18,597,840 C560S probably damaging Het
Zdhhc13 A G 7: 48,822,730 probably null Het
Other mutations in Ppp4r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ppp4r1 APN 17 65816019 missense probably benign 0.06
IGL01415:Ppp4r1 APN 17 65813527 missense probably damaging 1.00
IGL02166:Ppp4r1 APN 17 65813492 missense probably benign 0.01
IGL02672:Ppp4r1 APN 17 65840947 missense probably damaging 1.00
R0304:Ppp4r1 UTSW 17 65816006 missense probably benign
R0976:Ppp4r1 UTSW 17 65841018 makesense probably null
R1355:Ppp4r1 UTSW 17 65840987 missense probably benign
R2356:Ppp4r1 UTSW 17 65833050 missense probably damaging 0.99
R3054:Ppp4r1 UTSW 17 65836079 missense probably damaging 0.99
R4391:Ppp4r1 UTSW 17 65824754 missense probably benign 0.05
R4603:Ppp4r1 UTSW 17 65813464 missense probably damaging 1.00
R4763:Ppp4r1 UTSW 17 65835110 missense possibly damaging 0.90
R5571:Ppp4r1 UTSW 17 65803861 nonsense probably null
R5586:Ppp4r1 UTSW 17 65824568 missense probably benign 0.00
R5661:Ppp4r1 UTSW 17 65803968 critical splice donor site probably null
R5742:Ppp4r1 UTSW 17 65837746 missense probably damaging 0.97
R5971:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6079:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6138:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6303:Ppp4r1 UTSW 17 65824729 missense probably benign 0.10
R6684:Ppp4r1 UTSW 17 65824342 missense probably benign 0.00
U15987:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGTTCCTACATTAGAAGTTTTCCC -3'
(R):5'- TAATGCTCCGTGTCCAGTCAG -3'

Sequencing Primer
(F):5'- CTGGAACTCATTAGACCATGCTGG -3'
(R):5'- CGTGTCCAGTCAGGTTCATTTAGTAC -3'
Posted On2014-11-11