Incidental Mutation 'R2405:Ccny'
ID247988
Institutional Source Beutler Lab
Gene Symbol Ccny
Ensembl Gene ENSMUSG00000024286
Gene Namecyclin Y
Synonyms5730405I09Rik, 4631402G10Rik, 1700025H17Rik, 3110050L10Rik
MMRRC Submission 040371-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R2405 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location9314044-9450150 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9353480 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 98 (Y98H)
Ref Sequence ENSEMBL: ENSMUSP00000050001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053917]
Predicted Effect probably benign
Transcript: ENSMUST00000053917
AA Change: Y98H

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000050001
Gene: ENSMUSG00000024286
AA Change: Y98H

DomainStartEndE-ValueType
CYCLIN 173 258 1.36e-7 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cyclins, such as CCNY, control cell division cycles and regulate cyclin-dependent kinases (e.g., CDC2; MIM 116940) (Li et al., 2009 [PubMed 18060517]).[supplied by OMIM, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired adipogenesis and lipid production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Abl1 T C 2: 31,800,974 L835P possibly damaging Het
Ascc3 T A 10: 50,731,678 V1426D probably damaging Het
Ccser2 G A 14: 36,938,669 T509M probably damaging Het
Crnkl1 A T 2: 145,928,157 Y255* probably null Het
Cyp2d11 C T 15: 82,389,266 S468N possibly damaging Het
Dnah7b C A 1: 46,362,954 T3983N probably benign Het
Ebf1 T A 11: 44,991,522 M427K probably damaging Het
Fxr1 T A 3: 34,061,854 S438T probably damaging Het
Gabrr1 A T 4: 33,157,110 D209V probably damaging Het
Gbx2 G T 1: 89,930,908 probably benign Het
Gm5741 A G 8: 85,067,641 I56T possibly damaging Het
Gm884 T C 11: 103,620,984 M53V unknown Het
Gulo A G 14: 65,991,028 probably null Het
Hhla1 A T 15: 65,936,311 L295* probably null Het
Hmcn1 T A 1: 150,860,341 I126L probably damaging Het
Hpse A G 5: 100,708,771 S121P possibly damaging Het
Inpp5d A G 1: 87,699,729 H321R possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm5b T A 1: 134,609,016 M658K probably damaging Het
Kidins220 A T 12: 25,011,509 E875V probably damaging Het
Nlrp4b A G 7: 10,714,728 E286G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Pde3a A T 6: 141,481,242 I710F probably damaging Het
Phb T C 11: 95,675,268 I126T probably benign Het
Ppp4r1 C T 17: 65,811,346 T164I possibly damaging Het
Psmc1 G A 12: 100,120,103 R333Q probably benign Het
Pygb A G 2: 150,820,775 Y554C probably benign Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Serpina3a A T 12: 104,121,318 M357L possibly damaging Het
Serpinb9e T A 13: 33,260,080 M361K probably benign Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc15a2 G A 16: 36,751,837 Q691* probably null Het
Slc25a25 C T 2: 32,417,719 probably null Het
Slc34a2 A G 5: 53,058,181 N9S probably benign Het
Slc4a2 A G 5: 24,435,601 T665A probably damaging Het
Spef2 C A 15: 9,626,034 E1149* probably null Het
Tmem179 A G 12: 112,501,913 W45R probably damaging Het
Tmpo C A 10: 91,163,354 K190N probably damaging Het
Triml1 T C 8: 43,130,283 Y427C probably damaging Het
Trpm2 A G 10: 77,934,724 L720P probably damaging Het
Vmn1r60 A G 7: 5,544,913 Y63H probably benign Het
Vmn2r96 T A 17: 18,597,840 C560S probably damaging Het
Zdhhc13 A G 7: 48,822,730 probably null Het
Other mutations in Ccny
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Ccny APN 18 9345444 missense probably benign 0.18
IGL01986:Ccny APN 18 9377817 missense probably damaging 1.00
IGL03000:Ccny APN 18 9353489 missense probably benign 0.12
IGL03257:Ccny APN 18 9386747 missense possibly damaging 0.84
R0015:Ccny UTSW 18 9316682 splice site probably benign
R0015:Ccny UTSW 18 9316682 splice site probably benign
R0372:Ccny UTSW 18 9345201 missense probably damaging 1.00
R0440:Ccny UTSW 18 9332917 missense probably benign 0.21
R1645:Ccny UTSW 18 9345199 missense probably damaging 0.99
R2044:Ccny UTSW 18 9449644 missense probably damaging 1.00
R3847:Ccny UTSW 18 9449641 missense probably benign 0.37
R3864:Ccny UTSW 18 9449604 missense probably damaging 1.00
R4198:Ccny UTSW 18 9332928 missense probably damaging 0.96
R4964:Ccny UTSW 18 9449516 critical splice donor site probably null
R6474:Ccny UTSW 18 9345427 missense probably damaging 1.00
X0050:Ccny UTSW 18 9332874 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CCCAGAACTTAGGAGACAGAGGA -3'
(R):5'- CAGCCCCTTAGTGTGCTTTC -3'

Sequencing Primer
(F):5'- GATCTATGAGTTCAAGGCTAGCC -3'
(R):5'- AACTCATGGGTAGCACTGC -3'
Posted On2014-11-11