Incidental Mutation 'R2406:Fbxw5'
ID247990
Institutional Source Beutler Lab
Gene Symbol Fbxw5
Ensembl Gene ENSMUSG00000015095
Gene NameF-box and WD-40 domain protein 5
SynonymsFbw5
MMRRC Submission 040372-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R2406 (G1)
Quality Score220
Status Validated
Chromosome2
Chromosomal Location25500750-25505471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25504183 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 86 (I86T)
Ref Sequence ENSEMBL: ENSMUSP00000117676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015227] [ENSMUST00000015239] [ENSMUST00000040042] [ENSMUST00000124375]
Predicted Effect probably benign
Transcript: ENSMUST00000015227
SMART Domains Protein: ENSMUSP00000015227
Gene: ENSMUSG00000015083

DomainStartEndE-ValueType
Pfam:Lipocalin 14 152 3.3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000015239
AA Change: I370T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015239
Gene: ENSMUSG00000015095
AA Change: I370T

DomainStartEndE-ValueType
FBOX 9 49 7.7e-6 SMART
WD40 81 120 3.11e-10 SMART
WD40 456 500 1.98e1 SMART
WD40 503 542 6.28e-6 SMART
low complexity region 553 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040042
SMART Domains Protein: ENSMUSP00000041855
Gene: ENSMUSG00000015083

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Lipocalin 48 186 3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124258
Predicted Effect probably damaging
Transcript: ENSMUST00000124375
AA Change: I86T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117676
Gene: ENSMUSG00000015095
AA Change: I86T

DomainStartEndE-ValueType
SCOP:d1jjub_ 116 246 1e-11 SMART
Blast:WD40 172 216 2e-25 BLAST
Blast:WD40 219 246 7e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154984
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains WD-40 domains, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene, however, they were found to be nonsense-mediated mRNA decay (NMD) candidates, hence not represented. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,455 V230E probably damaging Het
Adam22 A T 5: 8,180,064 probably benign Het
AW554918 A G 18: 25,340,287 I180V possibly damaging Het
C9 T C 15: 6,483,299 S301P possibly damaging Het
Cdc42bpb T C 12: 111,302,124 Q1214R probably benign Het
Chaf1b T C 16: 93,900,155 I351T probably damaging Het
Clip1 T C 5: 123,603,660 E1177G probably damaging Het
Colgalt1 G A 8: 71,617,668 C198Y probably damaging Het
Dennd4b C T 3: 90,275,488 R871C probably damaging Het
Eif4ebp1 A G 8: 27,273,334 I52V probably damaging Het
Fam205a1 A T 4: 42,851,696 D153E probably benign Het
Gm10650 A G 3: 128,039,881 noncoding transcript Het
Gm11639 A T 11: 104,720,631 D433V probably benign Het
Helz G A 11: 107,686,552 A1910T unknown Het
Hsf2 C T 10: 57,497,546 T70I probably damaging Het
Ifih1 A G 2: 62,607,103 probably benign Het
Kdm2a T C 19: 4,322,518 D933G probably damaging Het
Macc1 T C 12: 119,465,611 I832T probably damaging Het
Mapk15 T C 15: 75,998,848 S512P possibly damaging Het
Mybpc2 A T 7: 44,521,725 I134N possibly damaging Het
Myh4 A G 11: 67,259,174 E1853G probably damaging Het
Ncoa3 T C 2: 166,055,359 V690A probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1447 A G 19: 12,901,627 V51A probably benign Het
Pacsin2 A T 15: 83,385,112 probably benign Het
Piezo2 A T 18: 63,022,525 L2416Q probably damaging Het
Pip5k1c T A 10: 81,309,024 I233N probably damaging Het
Ptcd3 T C 6: 71,888,647 D428G probably damaging Het
Ptprf T C 4: 118,269,304 D84G possibly damaging Het
Rasgrf2 T C 13: 91,972,240 D798G probably benign Het
Setd7 A G 3: 51,542,676 Y110H probably damaging Het
Sgta T C 10: 81,051,247 I61M possibly damaging Het
Shank1 A G 7: 44,356,952 D2031G possibly damaging Het
Skint5 A G 4: 113,942,667 Y88H probably damaging Het
Stox1 T C 10: 62,664,166 I872V probably benign Het
Tmc4 A G 7: 3,671,026 F385L probably benign Het
Top3a A G 11: 60,756,012 F258L probably damaging Het
Ttn T C 2: 76,950,155 Y1084C probably damaging Het
Ubtf A T 11: 102,308,702 Y504* probably null Het
Wdfy3 T C 5: 101,888,259 T2098A probably damaging Het
Wnk2 G T 13: 49,061,488 T1194K possibly damaging Het
Zbtb40 T A 4: 136,998,568 E560V probably benign Het
Other mutations in Fbxw5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02053:Fbxw5 APN 2 25503441 missense probably damaging 0.99
IGL02162:Fbxw5 APN 2 25503271 missense probably damaging 0.96
IGL02261:Fbxw5 APN 2 25503734 missense probably benign 0.01
IGL02298:Fbxw5 APN 2 25504444 nonsense probably null
IGL02822:Fbxw5 APN 2 25503010 missense probably benign 0.06
R0416:Fbxw5 UTSW 2 25503239 missense probably damaging 1.00
R0423:Fbxw5 UTSW 2 25504526 missense possibly damaging 0.90
R0616:Fbxw5 UTSW 2 25502505 missense probably damaging 1.00
R0730:Fbxw5 UTSW 2 25504618 missense possibly damaging 0.49
R1660:Fbxw5 UTSW 2 25503274 critical splice donor site probably null
R1697:Fbxw5 UTSW 2 25502461 missense possibly damaging 0.88
R1737:Fbxw5 UTSW 2 25503584 missense probably benign 0.01
R2030:Fbxw5 UTSW 2 25504798 missense probably damaging 1.00
R2274:Fbxw5 UTSW 2 25504761 nonsense probably null
R3815:Fbxw5 UTSW 2 25503564 missense possibly damaging 0.62
R4082:Fbxw5 UTSW 2 25504631 critical splice donor site probably null
R4249:Fbxw5 UTSW 2 25503460 missense probably damaging 0.98
R6170:Fbxw5 UTSW 2 25503603 missense possibly damaging 0.96
R6502:Fbxw5 UTSW 2 25502436 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CTGCCTTGGCACACTTGATC -3'
(R):5'- ATTAGATACAGGGCCAGCTGTG -3'

Sequencing Primer
(F):5'- GCACACTTGATCCTGTGTAAGAG -3'
(R):5'- GCCCATGCACATCAATGA -3'
Posted On2014-11-11