Incidental Mutation 'R2406:Gm10650'
ID247996
Institutional Source Beutler Lab
Gene Symbol Gm10650
Ensembl Gene ENSMUSG00000074237
Gene Namepredicted gene 10650
Synonyms
MMRRC Submission 040372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2406 (G1)
Quality Score216
Status Validated
Chromosome3
Chromosomal Location128038694-128040661 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 128039881 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196581
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,455 V230E probably damaging Het
Adam22 A T 5: 8,180,064 probably benign Het
AW554918 A G 18: 25,340,287 I180V possibly damaging Het
C9 T C 15: 6,483,299 S301P possibly damaging Het
Cdc42bpb T C 12: 111,302,124 Q1214R probably benign Het
Chaf1b T C 16: 93,900,155 I351T probably damaging Het
Clip1 T C 5: 123,603,660 E1177G probably damaging Het
Colgalt1 G A 8: 71,617,668 C198Y probably damaging Het
Dennd4b C T 3: 90,275,488 R871C probably damaging Het
Eif4ebp1 A G 8: 27,273,334 I52V probably damaging Het
Fam205a1 A T 4: 42,851,696 D153E probably benign Het
Fbxw5 T C 2: 25,504,183 I86T probably damaging Het
Gm11639 A T 11: 104,720,631 D433V probably benign Het
Helz G A 11: 107,686,552 A1910T unknown Het
Hsf2 C T 10: 57,497,546 T70I probably damaging Het
Ifih1 A G 2: 62,607,103 probably benign Het
Kdm2a T C 19: 4,322,518 D933G probably damaging Het
Macc1 T C 12: 119,465,611 I832T probably damaging Het
Mapk15 T C 15: 75,998,848 S512P possibly damaging Het
Mybpc2 A T 7: 44,521,725 I134N possibly damaging Het
Myh4 A G 11: 67,259,174 E1853G probably damaging Het
Ncoa3 T C 2: 166,055,359 V690A probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1447 A G 19: 12,901,627 V51A probably benign Het
Pacsin2 A T 15: 83,385,112 probably benign Het
Piezo2 A T 18: 63,022,525 L2416Q probably damaging Het
Pip5k1c T A 10: 81,309,024 I233N probably damaging Het
Ptcd3 T C 6: 71,888,647 D428G probably damaging Het
Ptprf T C 4: 118,269,304 D84G possibly damaging Het
Rasgrf2 T C 13: 91,972,240 D798G probably benign Het
Setd7 A G 3: 51,542,676 Y110H probably damaging Het
Sgta T C 10: 81,051,247 I61M possibly damaging Het
Shank1 A G 7: 44,356,952 D2031G possibly damaging Het
Skint5 A G 4: 113,942,667 Y88H probably damaging Het
Stox1 T C 10: 62,664,166 I872V probably benign Het
Tmc4 A G 7: 3,671,026 F385L probably benign Het
Top3a A G 11: 60,756,012 F258L probably damaging Het
Ttn T C 2: 76,950,155 Y1084C probably damaging Het
Ubtf A T 11: 102,308,702 Y504* probably null Het
Wdfy3 T C 5: 101,888,259 T2098A probably damaging Het
Wnk2 G T 13: 49,061,488 T1194K possibly damaging Het
Zbtb40 T A 4: 136,998,568 E560V probably benign Het
Other mutations in Gm10650
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02222:Gm10650 APN 3 128040140 exon noncoding transcript
R2230:Gm10650 UTSW 3 128039763 exon noncoding transcript
R5061:Gm10650 UTSW 3 128040017 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACAGCTTCCTTGTCTGTGTAG -3'
(R):5'- AGGCTAGCATACAAACGGCC -3'

Sequencing Primer
(F):5'- CCTATGCTGCAACATTAAAGTTCTC -3'
(R):5'- ATACAAACGGCCCCGGGTG -3'
Posted On2014-11-11