Incidental Mutation 'R2406:Skint5'
ID247998
Institutional Source Beutler Lab
Gene Symbol Skint5
Ensembl Gene ENSMUSG00000078598
Gene Nameselection and upkeep of intraepithelial T cells 5
SynonymsOTTMUSG00000008560
MMRRC Submission 040372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2406 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location113477891-113999503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113942667 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 88 (Y88H)
Ref Sequence ENSEMBL: ENSMUSP00000130639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169631] [ENSMUST00000170105] [ENSMUST00000171627]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153413
Predicted Effect probably damaging
Transcript: ENSMUST00000169631
AA Change: Y102H

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132470
Gene: ENSMUSG00000078598
AA Change: Y102H

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
IGv 58 139 2.48e-8 SMART
Blast:IG_like 173 249 2e-16 BLAST
internal_repeat_2 282 614 9.14e-29 PROSPERO
internal_repeat_1 284 770 2.19e-39 PROSPERO
low complexity region 772 781 N/A INTRINSIC
internal_repeat_1 808 1294 2.19e-39 PROSPERO
internal_repeat_2 995 1306 9.14e-29 PROSPERO
transmembrane domain 1322 1341 N/A INTRINSIC
transmembrane domain 1361 1383 N/A INTRINSIC
transmembrane domain 1398 1420 N/A INTRINSIC
transmembrane domain 1441 1463 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170105
AA Change: Y102H

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129582
Gene: ENSMUSG00000078598
AA Change: Y102H

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
IGv 58 139 2.48e-8 SMART
Pfam:C2-set_2 162 238 3.9e-6 PFAM
internal_repeat_3 276 364 2.13e-10 PROSPERO
internal_repeat_2 282 593 3.81e-24 PROSPERO
internal_repeat_1 284 749 6.25e-39 PROSPERO
low complexity region 751 760 N/A INTRINSIC
low complexity region 772 781 N/A INTRINSIC
internal_repeat_1 808 1273 6.25e-39 PROSPERO
internal_repeat_2 995 1285 3.81e-24 PROSPERO
internal_repeat_3 1196 1287 2.13e-10 PROSPERO
transmembrane domain 1301 1320 N/A INTRINSIC
transmembrane domain 1340 1362 N/A INTRINSIC
transmembrane domain 1377 1399 N/A INTRINSIC
transmembrane domain 1420 1442 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171627
AA Change: Y88H

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130639
Gene: ENSMUSG00000078598
AA Change: Y88H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.48e-8 SMART
Pfam:C2-set_2 147 225 3.1e-6 PFAM
internal_repeat_1 268 354 1.61e-12 PROSPERO
low complexity region 356 368 N/A INTRINSIC
low complexity region 380 388 N/A INTRINSIC
low complexity region 401 410 N/A INTRINSIC
internal_repeat_1 415 501 1.61e-12 PROSPERO
low complexity region 506 515 N/A INTRINSIC
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,455 V230E probably damaging Het
Adam22 A T 5: 8,180,064 probably benign Het
AW554918 A G 18: 25,340,287 I180V possibly damaging Het
C9 T C 15: 6,483,299 S301P possibly damaging Het
Cdc42bpb T C 12: 111,302,124 Q1214R probably benign Het
Chaf1b T C 16: 93,900,155 I351T probably damaging Het
Clip1 T C 5: 123,603,660 E1177G probably damaging Het
Colgalt1 G A 8: 71,617,668 C198Y probably damaging Het
Dennd4b C T 3: 90,275,488 R871C probably damaging Het
Eif4ebp1 A G 8: 27,273,334 I52V probably damaging Het
Fam205a1 A T 4: 42,851,696 D153E probably benign Het
Fbxw5 T C 2: 25,504,183 I86T probably damaging Het
Gm10650 A G 3: 128,039,881 noncoding transcript Het
Gm11639 A T 11: 104,720,631 D433V probably benign Het
Helz G A 11: 107,686,552 A1910T unknown Het
Hsf2 C T 10: 57,497,546 T70I probably damaging Het
Ifih1 A G 2: 62,607,103 probably benign Het
Kdm2a T C 19: 4,322,518 D933G probably damaging Het
Macc1 T C 12: 119,465,611 I832T probably damaging Het
Mapk15 T C 15: 75,998,848 S512P possibly damaging Het
Mybpc2 A T 7: 44,521,725 I134N possibly damaging Het
Myh4 A G 11: 67,259,174 E1853G probably damaging Het
Ncoa3 T C 2: 166,055,359 V690A probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1447 A G 19: 12,901,627 V51A probably benign Het
Pacsin2 A T 15: 83,385,112 probably benign Het
Piezo2 A T 18: 63,022,525 L2416Q probably damaging Het
Pip5k1c T A 10: 81,309,024 I233N probably damaging Het
Ptcd3 T C 6: 71,888,647 D428G probably damaging Het
Ptprf T C 4: 118,269,304 D84G possibly damaging Het
Rasgrf2 T C 13: 91,972,240 D798G probably benign Het
Setd7 A G 3: 51,542,676 Y110H probably damaging Het
Sgta T C 10: 81,051,247 I61M possibly damaging Het
Shank1 A G 7: 44,356,952 D2031G possibly damaging Het
Stox1 T C 10: 62,664,166 I872V probably benign Het
Tmc4 A G 7: 3,671,026 F385L probably benign Het
Top3a A G 11: 60,756,012 F258L probably damaging Het
Ttn T C 2: 76,950,155 Y1084C probably damaging Het
Ubtf A T 11: 102,308,702 Y504* probably null Het
Wdfy3 T C 5: 101,888,259 T2098A probably damaging Het
Wnk2 G T 13: 49,061,488 T1194K possibly damaging Het
Zbtb40 T A 4: 136,998,568 E560V probably benign Het
Other mutations in Skint5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Skint5 APN 4 113542873 critical splice donor site probably null
IGL01288:Skint5 APN 4 113524135 intron probably benign
IGL01313:Skint5 APN 4 113805164 missense unknown
IGL01446:Skint5 APN 4 113942822 missense probably damaging 1.00
IGL01861:Skint5 APN 4 113559824 splice site probably benign
IGL01955:Skint5 APN 4 113623736 critical splice donor site probably null
IGL02150:Skint5 APN 4 113885791 missense unknown
IGL02190:Skint5 APN 4 113940765 missense possibly damaging 0.93
IGL02271:Skint5 APN 4 113937581 splice site probably null
IGL02426:Skint5 APN 4 113940784 missense probably benign 0.08
IGL02484:Skint5 APN 4 113942553 nonsense probably null
IGL02548:Skint5 APN 4 113731076 missense unknown
IGL02556:Skint5 APN 4 113940735 missense probably damaging 0.99
IGL02674:Skint5 APN 4 113630385 splice site probably benign
IGL02697:Skint5 APN 4 113479713 missense probably benign 0.23
IGL02710:Skint5 APN 4 113477959 missense unknown
IGL02721:Skint5 APN 4 113942549 missense probably damaging 0.96
IGL02750:Skint5 APN 4 113539362 missense unknown
IGL03121:Skint5 APN 4 113717087 missense unknown
IGL03167:Skint5 APN 4 113893850 missense unknown
IGL03247:Skint5 APN 4 113940808 missense probably damaging 1.00
IGL03264:Skint5 APN 4 113486657 missense unknown
IGL03281:Skint5 APN 4 113667218 missense unknown
IGL03353:Skint5 APN 4 113742182 missense unknown
IGL03377:Skint5 APN 4 113763538 missense unknown
PIT4377001:Skint5 UTSW 4 113597703 missense unknown
R0006:Skint5 UTSW 4 113893862 splice site probably benign
R0026:Skint5 UTSW 4 113546468 splice site probably benign
R0096:Skint5 UTSW 4 113597768 splice site probably benign
R0096:Skint5 UTSW 4 113597768 splice site probably benign
R0277:Skint5 UTSW 4 113937621 missense probably benign 0.04
R0323:Skint5 UTSW 4 113937621 missense probably benign 0.04
R0369:Skint5 UTSW 4 113512023 critical splice donor site probably null
R0375:Skint5 UTSW 4 113705596 missense unknown
R0464:Skint5 UTSW 4 113535731 missense unknown
R0479:Skint5 UTSW 4 113655672 missense unknown
R0507:Skint5 UTSW 4 113567930 splice site probably null
R0533:Skint5 UTSW 4 113827867 missense unknown
R0628:Skint5 UTSW 4 113731069 nonsense probably null
R0645:Skint5 UTSW 4 113763482 missense unknown
R1201:Skint5 UTSW 4 113556145 missense unknown
R1240:Skint5 UTSW 4 113717107 missense unknown
R1270:Skint5 UTSW 4 113942659 nonsense probably null
R1390:Skint5 UTSW 4 113655684 missense unknown
R1398:Skint5 UTSW 4 113779071 missense unknown
R1438:Skint5 UTSW 4 113556111 splice site probably benign
R1591:Skint5 UTSW 4 113999454 critical splice donor site probably null
R1631:Skint5 UTSW 4 113483926 missense probably benign 0.23
R1653:Skint5 UTSW 4 113490678 missense unknown
R1722:Skint5 UTSW 4 113846311 splice site probably null
R1735:Skint5 UTSW 4 113563459 missense unknown
R1765:Skint5 UTSW 4 113577661 missense unknown
R2054:Skint5 UTSW 4 113819163 critical splice donor site probably null
R2058:Skint5 UTSW 4 113870700 missense possibly damaging 0.53
R2197:Skint5 UTSW 4 113940849 missense probably damaging 1.00
R2239:Skint5 UTSW 4 113546536 missense unknown
R2380:Skint5 UTSW 4 113546536 missense unknown
R2512:Skint5 UTSW 4 113630419 missense unknown
R2913:Skint5 UTSW 4 113524092 intron probably benign
R3522:Skint5 UTSW 4 113756905 critical splice donor site probably null
R3779:Skint5 UTSW 4 113779040 splice site probably benign
R3815:Skint5 UTSW 4 113629122 splice site probably benign
R3815:Skint5 UTSW 4 113846299 missense possibly damaging 0.86
R3816:Skint5 UTSW 4 113629122 splice site probably benign
R3817:Skint5 UTSW 4 113629122 splice site probably benign
R3818:Skint5 UTSW 4 113629122 splice site probably benign
R3837:Skint5 UTSW 4 113940741 missense probably damaging 1.00
R3943:Skint5 UTSW 4 113942753 missense probably damaging 1.00
R3944:Skint5 UTSW 4 113942753 missense probably damaging 1.00
R4037:Skint5 UTSW 4 113885814 missense unknown
R4038:Skint5 UTSW 4 113885814 missense unknown
R4039:Skint5 UTSW 4 113885814 missense unknown
R4280:Skint5 UTSW 4 113942552 missense probably damaging 1.00
R4308:Skint5 UTSW 4 113483967 missense unknown
R4386:Skint5 UTSW 4 113483893 missense probably benign 0.23
R4513:Skint5 UTSW 4 113742185 missense unknown
R4575:Skint5 UTSW 4 113667193 missense unknown
R4631:Skint5 UTSW 4 113629117 critical splice acceptor site probably null
R4722:Skint5 UTSW 4 113893855 missense unknown
R4854:Skint5 UTSW 4 113580528 missense unknown
R5010:Skint5 UTSW 4 113546537 missense unknown
R5070:Skint5 UTSW 4 113795538 missense unknown
R5158:Skint5 UTSW 4 113742212 missense unknown
R5163:Skint5 UTSW 4 113795565 missense unknown
R5190:Skint5 UTSW 4 113763514 missense unknown
R5232:Skint5 UTSW 4 113577644 missense unknown
R5257:Skint5 UTSW 4 113577662 missense unknown
R5499:Skint5 UTSW 4 113942503 critical splice donor site probably null
R5569:Skint5 UTSW 4 113688706 critical splice acceptor site probably null
R5776:Skint5 UTSW 4 113763503 missense unknown
R5986:Skint5 UTSW 4 113995648 missense probably benign 0.11
R5987:Skint5 UTSW 4 113885808 missense unknown
R5995:Skint5 UTSW 4 113893832 missense unknown
R6063:Skint5 UTSW 4 113490645 missense probably benign 0.23
R6074:Skint5 UTSW 4 113805200 missense unknown
R6111:Skint5 UTSW 4 113705648 missense unknown
R6173:Skint5 UTSW 4 113535710 missense unknown
R6238:Skint5 UTSW 4 113942867 splice site probably null
R6248:Skint5 UTSW 4 113779089 missense unknown
R6318:Skint5 UTSW 4 113517133 missense unknown
R6370:Skint5 UTSW 4 113614110 missense unknown
R6404:Skint5 UTSW 4 113942609 missense probably damaging 0.97
R6499:Skint5 UTSW 4 113539355 missense unknown
R6646:Skint5 UTSW 4 113940777 missense possibly damaging 0.94
R6737:Skint5 UTSW 4 113535739 missense unknown
R6795:Skint5 UTSW 4 113667223 missense unknown
R6815:Skint5 UTSW 4 113717127 critical splice acceptor site probably null
R6935:Skint5 UTSW 4 113942596 missense possibly damaging 0.56
R7028:Skint5 UTSW 4 113940839 missense probably damaging 1.00
R7043:Skint5 UTSW 4 113717107 missense unknown
R7071:Skint5 UTSW 4 113779080 missense unknown
R7142:Skint5 UTSW 4 113571594 missense unknown
R7197:Skint5 UTSW 4 113580482 critical splice donor site probably null
R7208:Skint5 UTSW 4 113539339 missense unknown
R7297:Skint5 UTSW 4 113542934 missense unknown
R7470:Skint5 UTSW 4 113756931 missense unknown
R7470:Skint5 UTSW 4 113885803 missense unknown
R7500:Skint5 UTSW 4 113559838 missense unknown
R7547:Skint5 UTSW 4 113626588 missense unknown
R7556:Skint5 UTSW 4 113567965 missense unknown
X0028:Skint5 UTSW 4 113691109 missense unknown
Predicted Primers PCR Primer
(F):5'- GAATCATGGATATACAGCAGTTGCAG -3'
(R):5'- TCCTCCGCAGAACAATTCACTG -3'

Sequencing Primer
(F):5'- TTGCAGAGGGATCCATGC -3'
(R):5'- CACTGTGAATGGCTTAGAGAGTCC -3'
Posted On2014-11-11