Mutagenetix > Incidental Mutation

Incidental Mutation 'R2406:Clip1'

248003

Institutional Source

Beutler Lab

Gene Symbol

Clip1

Ensembl Gene

ENSMUSG00000049550

Gene Name

CAP-GLY domain containing linker protein 1

Synonyms

Rsn, CLIP-170, 4631429H07Rik, restin, Clip 170, 1110007I12Rik, Clip50, cytoplasmic linker protein 50

MMRRC Submission

040372-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2406 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123715857-123822527 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123741723 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1177 (E1177G)

Ref Sequence

ENSEMBL: ENSMUSP00000031382 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031382] [ENSMUST00000063905] [ENSMUST00000111561] [ENSMUST00000111564] [ENSMUST00000111566]

AlphaFold

Q922J3

Predicted Effect

probably damaging
Transcript: ENSMUST00000031382
AA Change: E1177G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031382
Gene: ENSMUSG00000049550
AA Change: E1177G

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.28e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.28e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	451	N/A	INTRINSIC
coiled coil region	474	535	N/A	INTRINSIC
coiled coil region	581	620	N/A	INTRINSIC
coiled coil region	652	1352	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1375	1392	5.8e-9	PFAM
ZnF_C2HC	1417	1433	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000063905
AA Change: E1051G

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000068241
Gene: ENSMUSG00000049550
AA Change: E1051G

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	3.3e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	3.3e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1075	N/A	INTRINSIC
coiled coil region	1115	1235	N/A	INTRINSIC
low complexity region	1245	1256	N/A	INTRINSIC
ZnF_C2HC	1300	1316	1.45e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111561
AA Change: E1166G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107186
Gene: ENSMUSG00000049550
AA Change: E1166G

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	1.93e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	1.93e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1341	N/A	INTRINSIC
low complexity region	1351	1362	N/A	INTRINSIC
ZnF_C2HC	1406	1422	1.45e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111564
AA Change: E1055G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107190
Gene: ENSMUSG00000049550
AA Change: E1055G

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.5e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.5e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1230	N/A	INTRINSIC
low complexity region	1240	1251	N/A	INTRINSIC
ZnF_C2HC	1295	1311	1.45e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111566
AA Change: E1131G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107192
Gene: ENSMUSG00000049550
AA Change: E1131G

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1306	N/A	INTRINSIC
low complexity region	1316	1327	N/A	INTRINSIC
ZnF_C2HC	1371	1387	1.45e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125340

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133545

Predicted Effect

possibly damaging
Transcript: ENSMUST00000154672
AA Change: E978G

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000122064
Gene: ENSMUSG00000049550
AA Change: E978G

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
low complexity region	165	176	N/A	INTRINSIC
internal_repeat_1	352	375	1.56e-8	PROSPERO
internal_repeat_3	358	377	5.32e-6	PROSPERO
internal_repeat_1	450	473	1.56e-8	PROSPERO
internal_repeat_3	544	563	5.32e-6	PROSPERO
internal_repeat_2	553	575	2.88e-7	PROSPERO
low complexity region	735	744	N/A	INTRINSIC
internal_repeat_2	781	803	2.88e-7	PROSPERO
low complexity region	819	830	N/A	INTRINSIC
low complexity region	962	977	N/A	INTRINSIC
low complexity region	1081	1099	N/A	INTRINSIC
low complexity region	1110	1121	N/A	INTRINSIC
low complexity region	1164	1175	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000137363
AA Change: E803G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000121425
Gene: ENSMUSG00000049550
AA Change: E803G

Domain	Start	End	E-Value	Type
CAP_GLY	2	31	2.59e0	SMART
low complexity region	39	57	N/A	INTRINSIC
low complexity region	58	84	N/A	INTRINSIC
coiled coil region	101	276	N/A	INTRINSIC
coiled coil region	322	361	N/A	INTRINSIC
coiled coil region	393	980	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1004	1021	4.2e-9	PFAM
ZnF_C2HC	1046	1062	1.45e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137602

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154432

Meta Mutation Damage Score

0.1140

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 93.9%

Validation Efficiency

95% (42/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted allele display reduced male fertility and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	A	17: 35,879,352 (GRCm39)	V230E	probably damaging	Het
Adam22	A	T	5: 8,230,064 (GRCm39)		probably benign	Het
AW554918	A	G	18: 25,473,344 (GRCm39)	I180V	possibly damaging	Het
C9	T	C	15: 6,512,780 (GRCm39)	S301P	possibly damaging	Het
Cdc42bpb	T	C	12: 111,268,558 (GRCm39)	Q1214R	probably benign	Het
Chaf1b	T	C	16: 93,697,043 (GRCm39)	I351T	probably damaging	Het
Colgalt1	G	A	8: 72,070,312 (GRCm39)	C198Y	probably damaging	Het
Dennd4b	C	T	3: 90,182,795 (GRCm39)	R871C	probably damaging	Het
Efcab3	A	T	11: 104,611,457 (GRCm39)	D433V	probably benign	Het
Eif4ebp1	A	G	8: 27,763,362 (GRCm39)	I52V	probably damaging	Het
Fbxw5	T	C	2: 25,394,195 (GRCm39)	I86T	probably damaging	Het
Gm10650	A	G	3: 127,833,530 (GRCm39)		noncoding transcript	Het
Helz	G	A	11: 107,577,378 (GRCm39)	A1910T	unknown	Het
Hsf2	C	T	10: 57,373,642 (GRCm39)	T70I	probably damaging	Het
Ifih1	A	G	2: 62,437,447 (GRCm39)		probably benign	Het
Kdm2a	T	C	19: 4,372,546 (GRCm39)	D933G	probably damaging	Het
Macc1	T	C	12: 119,429,346 (GRCm39)	I832T	probably damaging	Het
Mapk15	T	C	15: 75,870,697 (GRCm39)	S512P	possibly damaging	Het
Mybpc2	A	T	7: 44,171,149 (GRCm39)	I134N	possibly damaging	Het
Myh4	A	G	11: 67,150,000 (GRCm39)	E1853G	probably damaging	Het
Ncoa3	T	C	2: 165,897,279 (GRCm39)	V690A	probably damaging	Het
Nsf	C	T	11: 103,821,578 (GRCm39)	E26K	possibly damaging	Het
Or5b97	A	G	19: 12,878,991 (GRCm39)	V51A	probably benign	Het
Pacsin2	A	T	15: 83,269,313 (GRCm39)		probably benign	Het
Piezo2	A	T	18: 63,155,596 (GRCm39)	L2416Q	probably damaging	Het
Pip5k1c	T	A	10: 81,144,858 (GRCm39)	I233N	probably damaging	Het
Ptcd3	T	C	6: 71,865,631 (GRCm39)	D428G	probably damaging	Het
Ptprf	T	C	4: 118,126,501 (GRCm39)	D84G	possibly damaging	Het
Rasgrf2	T	C	13: 92,120,359 (GRCm39)	D798G	probably benign	Het
Setd7	A	G	3: 51,450,097 (GRCm39)	Y110H	probably damaging	Het
Sgta	T	C	10: 80,887,081 (GRCm39)	I61M	possibly damaging	Het
Shank1	A	G	7: 44,006,376 (GRCm39)	D2031G	possibly damaging	Het
Skint5	A	G	4: 113,799,864 (GRCm39)	Y88H	probably damaging	Het
Spata31f1a	A	T	4: 42,851,696 (GRCm39)	D153E	probably benign	Het
Stox1	T	C	10: 62,499,945 (GRCm39)	I872V	probably benign	Het
Tmc4	A	G	7: 3,674,025 (GRCm39)	F385L	probably benign	Het
Top3a	A	G	11: 60,646,838 (GRCm39)	F258L	probably damaging	Het
Ttn	T	C	2: 76,780,499 (GRCm39)	Y1084C	probably damaging	Het
Ubtf	A	T	11: 102,199,528 (GRCm39)	Y504*	probably null	Het
Wdfy3	T	C	5: 102,036,125 (GRCm39)	T2098A	probably damaging	Het
Wnk2	G	T	13: 49,214,964 (GRCm39)	T1194K	possibly damaging	Het
Zbtb40	T	A	4: 136,725,879 (GRCm39)	E560V	probably benign	Het

Other mutations in Clip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Clip1	APN	5	123,741,717 (GRCm39)	missense	possibly damaging	0.94
IGL01067:Clip1	APN	5	123,768,867 (GRCm39)	missense	probably damaging	0.99
IGL01524:Clip1	APN	5	123,717,442 (GRCm39)	missense	probably damaging	1.00
IGL01632:Clip1	APN	5	123,755,559 (GRCm39)	missense	probably damaging	1.00
IGL01798:Clip1	APN	5	123,721,612 (GRCm39)	missense	probably damaging	1.00
IGL01874:Clip1	APN	5	123,741,729 (GRCm39)	missense	possibly damaging	0.50
IGL01908:Clip1	APN	5	123,761,270 (GRCm39)	splice site	probably benign
IGL02120:Clip1	APN	5	123,785,946 (GRCm39)	missense	probably damaging	1.00
IGL02309:Clip1	APN	5	123,755,763 (GRCm39)	missense	probably damaging	0.99
IGL02555:Clip1	APN	5	123,759,857 (GRCm39)	critical splice donor site	probably null
IGL03027:Clip1	APN	5	123,759,919 (GRCm39)	missense	probably benign	0.43
IGL03336:Clip1	APN	5	123,791,633 (GRCm39)	nonsense	probably null
IGL03365:Clip1	APN	5	123,721,649 (GRCm39)	missense	probably damaging	1.00
IGL02802:Clip1	UTSW	5	123,769,186 (GRCm39)	missense	probably damaging	1.00
PIT4812001:Clip1	UTSW	5	123,768,738 (GRCm39)	missense	probably benign	0.08
R0254:Clip1	UTSW	5	123,755,395 (GRCm39)	splice site	probably benign
R0401:Clip1	UTSW	5	123,791,852 (GRCm39)	missense	probably damaging	1.00
R0530:Clip1	UTSW	5	123,778,594 (GRCm39)	missense	probably damaging	1.00
R0744:Clip1	UTSW	5	123,768,784 (GRCm39)	missense	probably benign	0.05
R0833:Clip1	UTSW	5	123,768,784 (GRCm39)	missense	probably benign	0.05
R1116:Clip1	UTSW	5	123,717,554 (GRCm39)	missense	probably damaging	0.99
R1182:Clip1	UTSW	5	123,785,928 (GRCm39)	missense	probably damaging	1.00
R1656:Clip1	UTSW	5	123,768,466 (GRCm39)	missense	possibly damaging	0.61
R1700:Clip1	UTSW	5	123,768,433 (GRCm39)	missense	probably benign
R1889:Clip1	UTSW	5	123,791,559 (GRCm39)	missense	probably damaging	0.99
R1975:Clip1	UTSW	5	123,761,281 (GRCm39)	missense	possibly damaging	0.79
R3545:Clip1	UTSW	5	123,769,141 (GRCm39)	missense	probably damaging	1.00
R3547:Clip1	UTSW	5	123,769,141 (GRCm39)	missense	probably damaging	1.00
R3548:Clip1	UTSW	5	123,769,141 (GRCm39)	missense	probably damaging	1.00
R3911:Clip1	UTSW	5	123,728,897 (GRCm39)	missense	probably damaging	1.00
R3944:Clip1	UTSW	5	123,755,892 (GRCm39)	unclassified	probably benign
R4660:Clip1	UTSW	5	123,717,437 (GRCm39)	missense	probably damaging	0.98
R4784:Clip1	UTSW	5	123,717,356 (GRCm39)	missense	probably damaging	1.00
R4785:Clip1	UTSW	5	123,717,356 (GRCm39)	missense	probably damaging	1.00
R4824:Clip1	UTSW	5	123,769,086 (GRCm39)	missense	probably damaging	1.00
R4831:Clip1	UTSW	5	123,721,664 (GRCm39)	missense	probably damaging	1.00
R4951:Clip1	UTSW	5	123,768,408 (GRCm39)	missense	probably benign	0.02
R4960:Clip1	UTSW	5	123,792,066 (GRCm39)	nonsense	probably null
R5014:Clip1	UTSW	5	123,755,793 (GRCm39)	missense	probably damaging	0.99
R5116:Clip1	UTSW	5	123,768,770 (GRCm39)	missense	probably benign	0.05
R5212:Clip1	UTSW	5	123,768,744 (GRCm39)	missense	probably benign	0.09
R5238:Clip1	UTSW	5	123,785,946 (GRCm39)	missense	probably damaging	1.00
R5318:Clip1	UTSW	5	123,751,147 (GRCm39)	unclassified	probably benign
R5372:Clip1	UTSW	5	123,768,303 (GRCm39)	missense	probably benign	0.02
R5701:Clip1	UTSW	5	123,751,366 (GRCm39)	unclassified	probably benign
R5734:Clip1	UTSW	5	123,753,217 (GRCm39)	unclassified	probably benign
R5757:Clip1	UTSW	5	123,765,460 (GRCm39)	missense	probably benign	0.21
R6024:Clip1	UTSW	5	123,753,152 (GRCm39)	missense	possibly damaging	0.66
R6160:Clip1	UTSW	5	123,751,604 (GRCm39)	missense	possibly damaging	0.66
R6177:Clip1	UTSW	5	123,751,897 (GRCm39)	unclassified	probably benign
R6183:Clip1	UTSW	5	123,780,667 (GRCm39)	missense	probably damaging	1.00
R6377:Clip1	UTSW	5	123,741,717 (GRCm39)	missense	possibly damaging	0.50
R6436:Clip1	UTSW	5	123,779,848 (GRCm39)	missense	probably damaging	1.00
R6471:Clip1	UTSW	5	123,778,612 (GRCm39)	missense	probably damaging	0.99
R6766:Clip1	UTSW	5	123,752,827 (GRCm39)	unclassified	probably benign
R7015:Clip1	UTSW	5	123,751,675 (GRCm39)	unclassified	probably benign
R7094:Clip1	UTSW	5	123,761,333 (GRCm39)	missense	probably benign	0.02
R7143:Clip1	UTSW	5	123,791,673 (GRCm39)	missense	probably benign
R7222:Clip1	UTSW	5	123,749,904 (GRCm39)	missense	probably damaging	0.99
R7233:Clip1	UTSW	5	123,749,922 (GRCm39)	missense	probably damaging	1.00
R7238:Clip1	UTSW	5	123,751,328 (GRCm39)	missense
R7249:Clip1	UTSW	5	123,741,663 (GRCm39)	missense	probably damaging	1.00
R7283:Clip1	UTSW	5	123,751,857 (GRCm39)	missense
R7295:Clip1	UTSW	5	123,765,419 (GRCm39)	missense	probably benign	0.19
R7447:Clip1	UTSW	5	123,791,696 (GRCm39)	missense	probably benign	0.03
R7458:Clip1	UTSW	5	123,778,609 (GRCm39)	missense	probably damaging	1.00
R7483:Clip1	UTSW	5	123,755,447 (GRCm39)	missense	probably benign	0.00
R7516:Clip1	UTSW	5	123,721,448 (GRCm39)	missense	probably benign	0.00
R7619:Clip1	UTSW	5	123,752,342 (GRCm39)	missense
R7831:Clip1	UTSW	5	123,751,342 (GRCm39)	missense
R7897:Clip1	UTSW	5	123,760,861 (GRCm39)	missense	probably benign
R8155:Clip1	UTSW	5	123,751,699 (GRCm39)	missense
R8157:Clip1	UTSW	5	123,768,782 (GRCm39)	missense	probably benign	0.17
R8232:Clip1	UTSW	5	123,785,981 (GRCm39)	missense	probably benign	0.05
R8396:Clip1	UTSW	5	123,780,627 (GRCm39)	missense	probably damaging	1.00
R8446:Clip1	UTSW	5	123,794,008 (GRCm39)	missense	probably damaging	1.00
R8486:Clip1	UTSW	5	123,752,770 (GRCm39)	unclassified	probably benign
R8511:Clip1	UTSW	5	123,791,969 (GRCm39)	missense	possibly damaging	0.50
R8731:Clip1	UTSW	5	123,752,756 (GRCm39)	missense
R8889:Clip1	UTSW	5	123,717,565 (GRCm39)	missense	probably benign	0.00
R8892:Clip1	UTSW	5	123,717,565 (GRCm39)	missense	probably benign	0.00
R9058:Clip1	UTSW	5	123,752,645 (GRCm39)	missense
R9106:Clip1	UTSW	5	123,753,223 (GRCm39)	missense	probably damaging	0.97
R9212:Clip1	UTSW	5	123,721,399 (GRCm39)	missense	probably damaging	1.00
R9217:Clip1	UTSW	5	123,717,441 (GRCm39)	missense	probably damaging	1.00
R9223:Clip1	UTSW	5	123,784,337 (GRCm39)	missense	probably damaging	1.00
R9325:Clip1	UTSW	5	123,751,186 (GRCm39)	missense
R9752:Clip1	UTSW	5	123,760,009 (GRCm39)	missense	probably damaging	1.00
Z1177:Clip1	UTSW	5	123,755,413 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TATAGCCGTGTGCATCCCTG -3'
(R):5'- ATCTTATCAGGCACGTGACC -3'

Sequencing Primer
(F):5'- TGCATCCCTGGAAGCAAAG -3'
(R):5'- AGGCACGTGACCCAGATCTATTTTC -3'

Posted On

2014-11-11