Incidental Mutation 'R2406:Ptcd3'
ID248005
Institutional Source Beutler Lab
Gene Symbol Ptcd3
Ensembl Gene ENSMUSG00000063884
Gene Namepentatricopeptide repeat domain 3
Synonyms2610034F17Rik, 2810422B04Rik
MMRRC Submission 040372-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2406 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location71880638-71908750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71888647 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 428 (D428G)
Ref Sequence ENSEMBL: ENSMUSP00000080743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082094] [ENSMUST00000206879]
Predicted Effect probably damaging
Transcript: ENSMUST00000082094
AA Change: D428G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080743
Gene: ENSMUSG00000063884
AA Change: D428G

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 216 227 N/A INTRINSIC
Pfam:PPR_2 253 300 1.4e-10 PFAM
Pfam:PPR_3 331 366 2.1e-4 PFAM
low complexity region 671 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206762
Predicted Effect probably benign
Transcript: ENSMUST00000206879
Meta Mutation Damage Score 0.548 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,455 V230E probably damaging Het
Adam22 A T 5: 8,180,064 probably benign Het
AW554918 A G 18: 25,340,287 I180V possibly damaging Het
C9 T C 15: 6,483,299 S301P possibly damaging Het
Cdc42bpb T C 12: 111,302,124 Q1214R probably benign Het
Chaf1b T C 16: 93,900,155 I351T probably damaging Het
Clip1 T C 5: 123,603,660 E1177G probably damaging Het
Colgalt1 G A 8: 71,617,668 C198Y probably damaging Het
Dennd4b C T 3: 90,275,488 R871C probably damaging Het
Eif4ebp1 A G 8: 27,273,334 I52V probably damaging Het
Fam205a1 A T 4: 42,851,696 D153E probably benign Het
Fbxw5 T C 2: 25,504,183 I86T probably damaging Het
Gm10650 A G 3: 128,039,881 noncoding transcript Het
Gm11639 A T 11: 104,720,631 D433V probably benign Het
Helz G A 11: 107,686,552 A1910T unknown Het
Hsf2 C T 10: 57,497,546 T70I probably damaging Het
Ifih1 A G 2: 62,607,103 probably benign Het
Kdm2a T C 19: 4,322,518 D933G probably damaging Het
Macc1 T C 12: 119,465,611 I832T probably damaging Het
Mapk15 T C 15: 75,998,848 S512P possibly damaging Het
Mybpc2 A T 7: 44,521,725 I134N possibly damaging Het
Myh4 A G 11: 67,259,174 E1853G probably damaging Het
Ncoa3 T C 2: 166,055,359 V690A probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1447 A G 19: 12,901,627 V51A probably benign Het
Pacsin2 A T 15: 83,385,112 probably benign Het
Piezo2 A T 18: 63,022,525 L2416Q probably damaging Het
Pip5k1c T A 10: 81,309,024 I233N probably damaging Het
Ptprf T C 4: 118,269,304 D84G possibly damaging Het
Rasgrf2 T C 13: 91,972,240 D798G probably benign Het
Setd7 A G 3: 51,542,676 Y110H probably damaging Het
Sgta T C 10: 81,051,247 I61M possibly damaging Het
Shank1 A G 7: 44,356,952 D2031G possibly damaging Het
Skint5 A G 4: 113,942,667 Y88H probably damaging Het
Stox1 T C 10: 62,664,166 I872V probably benign Het
Tmc4 A G 7: 3,671,026 F385L probably benign Het
Top3a A G 11: 60,756,012 F258L probably damaging Het
Ttn T C 2: 76,950,155 Y1084C probably damaging Het
Ubtf A T 11: 102,308,702 Y504* probably null Het
Wdfy3 T C 5: 101,888,259 T2098A probably damaging Het
Wnk2 G T 13: 49,061,488 T1194K possibly damaging Het
Zbtb40 T A 4: 136,998,568 E560V probably benign Het
Other mutations in Ptcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Ptcd3 APN 6 71903448 missense probably damaging 0.96
IGL00903:Ptcd3 APN 6 71907844 missense possibly damaging 0.93
IGL01545:Ptcd3 APN 6 71888577 missense probably benign 0.01
IGL01924:Ptcd3 APN 6 71898427 missense probably damaging 1.00
IGL02675:Ptcd3 APN 6 71883442 critical splice donor site probably null
R0732:Ptcd3 UTSW 6 71881171 unclassified probably benign
R1374:Ptcd3 UTSW 6 71908653 nonsense probably null
R1393:Ptcd3 UTSW 6 71889621 missense probably benign 0.00
R1498:Ptcd3 UTSW 6 71893495 missense probably damaging 1.00
R1646:Ptcd3 UTSW 6 71898395 missense probably benign 0.26
R1712:Ptcd3 UTSW 6 71908653 nonsense probably null
R2022:Ptcd3 UTSW 6 71885553 missense probably damaging 1.00
R2248:Ptcd3 UTSW 6 71894285 critical splice donor site probably null
R3418:Ptcd3 UTSW 6 71883486 missense possibly damaging 0.93
R3419:Ptcd3 UTSW 6 71883486 missense possibly damaging 0.93
R4677:Ptcd3 UTSW 6 71893514 missense probably benign 0.17
R4741:Ptcd3 UTSW 6 71902949 missense probably damaging 1.00
R4752:Ptcd3 UTSW 6 71901312 missense probably damaging 0.99
R5441:Ptcd3 UTSW 6 71881521 missense possibly damaging 0.62
R5583:Ptcd3 UTSW 6 71902936 missense probably damaging 1.00
R5681:Ptcd3 UTSW 6 71907659 missense probably damaging 1.00
R6028:Ptcd3 UTSW 6 71898408 missense probably damaging 1.00
R6324:Ptcd3 UTSW 6 71885327 missense probably benign 0.00
R6537:Ptcd3 UTSW 6 71897110 splice site probably null
R6600:Ptcd3 UTSW 6 71883546 missense probably damaging 1.00
R6783:Ptcd3 UTSW 6 71908643 missense probably benign 0.00
R6810:Ptcd3 UTSW 6 71885532 missense probably damaging 0.99
R6860:Ptcd3 UTSW 6 71897110 splice site probably null
R6993:Ptcd3 UTSW 6 71885315 missense probably damaging 1.00
X0024:Ptcd3 UTSW 6 71901274 missense probably damaging 1.00
X0065:Ptcd3 UTSW 6 71907806 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCCACTGCTGAATCTAGC -3'
(R):5'- CAGTGCTGGTACTTGAAGCTG -3'

Sequencing Primer
(F):5'- TCCTTGGTCCAAAATCATGAGGG -3'
(R):5'- CATGGTGATTTTGATAGTACAGTGC -3'
Posted On2014-11-11