Incidental Mutation 'R2406:Colgalt1'
ID248010
Institutional Source Beutler Lab
Gene Symbol Colgalt1
Ensembl Gene ENSMUSG00000034807
Gene Namecollagen beta(1-O)galactosyltransferase 1
SynonymsGlt25d1, 2810024B22Rik
MMRRC Submission 040372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R2406 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71610998-71624911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71617668 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 198 (C198Y)
Ref Sequence ENSEMBL: ENSMUSP00000047923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047903]
Predicted Effect probably damaging
Transcript: ENSMUST00000047903
AA Change: C198Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047923
Gene: ENSMUSG00000034807
AA Change: C198Y

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 56 176 4.6e-22 PFAM
Pfam:Glyco_transf_25 335 520 8.8e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212706
Meta Mutation Damage Score 0.508 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two enzymes that transfers galactose moieties to hydroxylysine residues of collagen and mannose binding lectin. This gene is constitutively expressed and encodes a soluble protein that localizes to the endoplasmic reticulum. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,455 V230E probably damaging Het
Adam22 A T 5: 8,180,064 probably benign Het
AW554918 A G 18: 25,340,287 I180V possibly damaging Het
C9 T C 15: 6,483,299 S301P possibly damaging Het
Cdc42bpb T C 12: 111,302,124 Q1214R probably benign Het
Chaf1b T C 16: 93,900,155 I351T probably damaging Het
Clip1 T C 5: 123,603,660 E1177G probably damaging Het
Dennd4b C T 3: 90,275,488 R871C probably damaging Het
Eif4ebp1 A G 8: 27,273,334 I52V probably damaging Het
Fam205a1 A T 4: 42,851,696 D153E probably benign Het
Fbxw5 T C 2: 25,504,183 I86T probably damaging Het
Gm10650 A G 3: 128,039,881 noncoding transcript Het
Gm11639 A T 11: 104,720,631 D433V probably benign Het
Helz G A 11: 107,686,552 A1910T unknown Het
Hsf2 C T 10: 57,497,546 T70I probably damaging Het
Ifih1 A G 2: 62,607,103 probably benign Het
Kdm2a T C 19: 4,322,518 D933G probably damaging Het
Macc1 T C 12: 119,465,611 I832T probably damaging Het
Mapk15 T C 15: 75,998,848 S512P possibly damaging Het
Mybpc2 A T 7: 44,521,725 I134N possibly damaging Het
Myh4 A G 11: 67,259,174 E1853G probably damaging Het
Ncoa3 T C 2: 166,055,359 V690A probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1447 A G 19: 12,901,627 V51A probably benign Het
Pacsin2 A T 15: 83,385,112 probably benign Het
Piezo2 A T 18: 63,022,525 L2416Q probably damaging Het
Pip5k1c T A 10: 81,309,024 I233N probably damaging Het
Ptcd3 T C 6: 71,888,647 D428G probably damaging Het
Ptprf T C 4: 118,269,304 D84G possibly damaging Het
Rasgrf2 T C 13: 91,972,240 D798G probably benign Het
Setd7 A G 3: 51,542,676 Y110H probably damaging Het
Sgta T C 10: 81,051,247 I61M possibly damaging Het
Shank1 A G 7: 44,356,952 D2031G possibly damaging Het
Skint5 A G 4: 113,942,667 Y88H probably damaging Het
Stox1 T C 10: 62,664,166 I872V probably benign Het
Tmc4 A G 7: 3,671,026 F385L probably benign Het
Top3a A G 11: 60,756,012 F258L probably damaging Het
Ttn T C 2: 76,950,155 Y1084C probably damaging Het
Ubtf A T 11: 102,308,702 Y504* probably null Het
Wdfy3 T C 5: 101,888,259 T2098A probably damaging Het
Wnk2 G T 13: 49,061,488 T1194K possibly damaging Het
Zbtb40 T A 4: 136,998,568 E560V probably benign Het
Other mutations in Colgalt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Colgalt1 APN 8 71622776 missense probably damaging 1.00
IGL01888:Colgalt1 APN 8 71617674 missense probably damaging 1.00
IGL03191:Colgalt1 APN 8 71623087 splice site probably null
P0041:Colgalt1 UTSW 8 71622790 missense probably benign 0.05
R0094:Colgalt1 UTSW 8 71623158 missense probably damaging 1.00
R0094:Colgalt1 UTSW 8 71623158 missense probably damaging 1.00
R1342:Colgalt1 UTSW 8 71618160 missense probably damaging 1.00
R1642:Colgalt1 UTSW 8 71620757 missense probably benign 0.01
R1754:Colgalt1 UTSW 8 71623179 missense probably damaging 1.00
R1830:Colgalt1 UTSW 8 71623137 missense probably damaging 0.99
R1844:Colgalt1 UTSW 8 71611351 missense possibly damaging 0.84
R2050:Colgalt1 UTSW 8 71617686 critical splice donor site probably null
R2393:Colgalt1 UTSW 8 71623741 missense probably benign 0.00
R3897:Colgalt1 UTSW 8 71619662 missense probably damaging 1.00
R4210:Colgalt1 UTSW 8 71622706 missense probably benign 0.34
R4909:Colgalt1 UTSW 8 71620633 missense possibly damaging 0.80
R5428:Colgalt1 UTSW 8 71622776 missense probably damaging 1.00
R5995:Colgalt1 UTSW 8 71623110 missense probably damaging 1.00
R6170:Colgalt1 UTSW 8 71621870 missense probably damaging 1.00
R6994:Colgalt1 UTSW 8 71623521 missense probably damaging 1.00
R6995:Colgalt1 UTSW 8 71623521 missense probably damaging 1.00
R7155:Colgalt1 UTSW 8 71623710 missense probably damaging 0.99
X0066:Colgalt1 UTSW 8 71623596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTACTGAGCCACCACAGAGG -3'
(R):5'- TGAATTTGGGCCAGATTCTCAC -3'

Sequencing Primer
(F):5'- ATTGAGAGAACTCGGGCTCC -3'
(R):5'- GGCCAGATTCTCACCACCAC -3'
Posted On2014-11-11