Mutagenetix > Incidental Mutation

Incidental Mutation 'R2406:Rasgrf2'

248024

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf2

Ensembl Gene

ENSMUSG00000021708

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 2

Synonyms

Grf2, 6330417G04Rik

MMRRC Submission

040372-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R2406 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92028519-92268164 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92120359 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 798 (D798G)

Ref Sequence

ENSEMBL: ENSMUSP00000096930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099326]

AlphaFold

P70392

Predicted Effect

probably benign
Transcript: ENSMUST00000099326
AA Change: D798G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: D798G

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
RhoGEF	247	428	2.2e-51	SMART
RasGEFN	633	775	9.35e-15	SMART
RasGEFN	786	923	6.04e-9	SMART
RasGEF	949	1186	2.97e-112	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000142378
AA Change: D198G

SMART Domains

Protein: ENSMUSP00000115401
Gene: ENSMUSG00000021708
AA Change: D198G

Domain	Start	End	E-Value	Type
RasGEFN	33	175	9.35e-15	SMART
Blast:RasGEFN	187	249	8e-29	BLAST

Predicted Effect

unknown
Transcript: ENSMUST00000151408
AA Change: D197G

SMART Domains

Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: D197G

Domain	Start	End	E-Value	Type
RasGEFN	33	175	9.35e-15	SMART
RasGEFN	186	323	6.04e-9	SMART
RasGEF	349	586	2.97e-112	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 93.9%

Validation Efficiency

95% (42/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	A	17: 35,879,352 (GRCm39)	V230E	probably damaging	Het
Adam22	A	T	5: 8,230,064 (GRCm39)		probably benign	Het
AW554918	A	G	18: 25,473,344 (GRCm39)	I180V	possibly damaging	Het
C9	T	C	15: 6,512,780 (GRCm39)	S301P	possibly damaging	Het
Cdc42bpb	T	C	12: 111,268,558 (GRCm39)	Q1214R	probably benign	Het
Chaf1b	T	C	16: 93,697,043 (GRCm39)	I351T	probably damaging	Het
Clip1	T	C	5: 123,741,723 (GRCm39)	E1177G	probably damaging	Het
Colgalt1	G	A	8: 72,070,312 (GRCm39)	C198Y	probably damaging	Het
Dennd4b	C	T	3: 90,182,795 (GRCm39)	R871C	probably damaging	Het
Efcab3	A	T	11: 104,611,457 (GRCm39)	D433V	probably benign	Het
Eif4ebp1	A	G	8: 27,763,362 (GRCm39)	I52V	probably damaging	Het
Fbxw5	T	C	2: 25,394,195 (GRCm39)	I86T	probably damaging	Het
Gm10650	A	G	3: 127,833,530 (GRCm39)		noncoding transcript	Het
Helz	G	A	11: 107,577,378 (GRCm39)	A1910T	unknown	Het
Hsf2	C	T	10: 57,373,642 (GRCm39)	T70I	probably damaging	Het
Ifih1	A	G	2: 62,437,447 (GRCm39)		probably benign	Het
Kdm2a	T	C	19: 4,372,546 (GRCm39)	D933G	probably damaging	Het
Macc1	T	C	12: 119,429,346 (GRCm39)	I832T	probably damaging	Het
Mapk15	T	C	15: 75,870,697 (GRCm39)	S512P	possibly damaging	Het
Mybpc2	A	T	7: 44,171,149 (GRCm39)	I134N	possibly damaging	Het
Myh4	A	G	11: 67,150,000 (GRCm39)	E1853G	probably damaging	Het
Ncoa3	T	C	2: 165,897,279 (GRCm39)	V690A	probably damaging	Het
Nsf	C	T	11: 103,821,578 (GRCm39)	E26K	possibly damaging	Het
Or5b97	A	G	19: 12,878,991 (GRCm39)	V51A	probably benign	Het
Pacsin2	A	T	15: 83,269,313 (GRCm39)		probably benign	Het
Piezo2	A	T	18: 63,155,596 (GRCm39)	L2416Q	probably damaging	Het
Pip5k1c	T	A	10: 81,144,858 (GRCm39)	I233N	probably damaging	Het
Ptcd3	T	C	6: 71,865,631 (GRCm39)	D428G	probably damaging	Het
Ptprf	T	C	4: 118,126,501 (GRCm39)	D84G	possibly damaging	Het
Setd7	A	G	3: 51,450,097 (GRCm39)	Y110H	probably damaging	Het
Sgta	T	C	10: 80,887,081 (GRCm39)	I61M	possibly damaging	Het
Shank1	A	G	7: 44,006,376 (GRCm39)	D2031G	possibly damaging	Het
Skint5	A	G	4: 113,799,864 (GRCm39)	Y88H	probably damaging	Het
Spata31f1a	A	T	4: 42,851,696 (GRCm39)	D153E	probably benign	Het
Stox1	T	C	10: 62,499,945 (GRCm39)	I872V	probably benign	Het
Tmc4	A	G	7: 3,674,025 (GRCm39)	F385L	probably benign	Het
Top3a	A	G	11: 60,646,838 (GRCm39)	F258L	probably damaging	Het
Ttn	T	C	2: 76,780,499 (GRCm39)	Y1084C	probably damaging	Het
Ubtf	A	T	11: 102,199,528 (GRCm39)	Y504*	probably null	Het
Wdfy3	T	C	5: 102,036,125 (GRCm39)	T2098A	probably damaging	Het
Wnk2	G	T	13: 49,214,964 (GRCm39)	T1194K	possibly damaging	Het
Zbtb40	T	A	4: 136,725,879 (GRCm39)	E560V	probably benign	Het

Other mutations in Rasgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Rasgrf2	APN	13	92,159,425 (GRCm39)	splice site	probably benign
IGL01358:Rasgrf2	APN	13	92,130,749 (GRCm39)	missense	probably benign	0.23
IGL01666:Rasgrf2	APN	13	92,174,718 (GRCm39)	missense	probably damaging	1.00
IGL01930:Rasgrf2	APN	13	92,130,857 (GRCm39)	missense	probably damaging	0.98
IGL02230:Rasgrf2	APN	13	92,136,145 (GRCm39)	missense	probably damaging	1.00
IGL02630:Rasgrf2	APN	13	92,267,900 (GRCm39)	missense	probably damaging	1.00
IGL02690:Rasgrf2	APN	13	92,167,273 (GRCm39)	missense	probably damaging	1.00
IGL02943:Rasgrf2	APN	13	92,131,752 (GRCm39)	missense	probably damaging	1.00
IGL03067:Rasgrf2	APN	13	92,159,413 (GRCm39)	missense	probably damaging	0.97
IGL03342:Rasgrf2	APN	13	92,136,098 (GRCm39)	missense	probably damaging	1.00
IGL03405:Rasgrf2	APN	13	92,044,170 (GRCm39)	missense	probably damaging	1.00
R0620:Rasgrf2	UTSW	13	92,067,936 (GRCm39)	splice site	probably benign
R0632:Rasgrf2	UTSW	13	92,120,393 (GRCm39)	missense	probably benign	0.00
R0894:Rasgrf2	UTSW	13	92,130,890 (GRCm39)	missense	probably damaging	1.00
R1354:Rasgrf2	UTSW	13	92,165,174 (GRCm39)	missense	probably damaging	1.00
R1400:Rasgrf2	UTSW	13	92,035,808 (GRCm39)	missense	probably damaging	1.00
R1437:Rasgrf2	UTSW	13	92,167,396 (GRCm39)	missense	probably damaging	1.00
R1443:Rasgrf2	UTSW	13	92,131,795 (GRCm39)	missense	probably damaging	1.00
R1522:Rasgrf2	UTSW	13	92,044,205 (GRCm39)	missense	probably benign	0.00
R1553:Rasgrf2	UTSW	13	92,038,783 (GRCm39)	missense	probably damaging	1.00
R1613:Rasgrf2	UTSW	13	92,050,740 (GRCm39)	missense	probably damaging	1.00
R1883:Rasgrf2	UTSW	13	92,117,149 (GRCm39)	missense	probably benign
R1934:Rasgrf2	UTSW	13	92,131,825 (GRCm39)	splice site	probably null
R1990:Rasgrf2	UTSW	13	92,172,473 (GRCm39)	missense	probably damaging	1.00
R2037:Rasgrf2	UTSW	13	92,050,748 (GRCm39)	missense	probably damaging	0.99
R2043:Rasgrf2	UTSW	13	92,167,351 (GRCm39)	missense	possibly damaging	0.91
R2135:Rasgrf2	UTSW	13	92,120,374 (GRCm39)	missense	probably benign
R2193:Rasgrf2	UTSW	13	92,160,221 (GRCm39)	splice site	probably null
R3055:Rasgrf2	UTSW	13	92,165,583 (GRCm39)	missense	probably damaging	1.00
R3916:Rasgrf2	UTSW	13	92,167,296 (GRCm39)	missense	probably damaging	1.00
R3954:Rasgrf2	UTSW	13	92,130,974 (GRCm39)	missense	probably damaging	0.98
R3955:Rasgrf2	UTSW	13	92,130,974 (GRCm39)	missense	probably damaging	0.98
R3956:Rasgrf2	UTSW	13	92,130,974 (GRCm39)	missense	probably damaging	0.98
R4133:Rasgrf2	UTSW	13	92,130,773 (GRCm39)	missense	possibly damaging	0.59
R4177:Rasgrf2	UTSW	13	92,038,717 (GRCm39)	missense	probably damaging	1.00
R4178:Rasgrf2	UTSW	13	92,038,717 (GRCm39)	missense	probably damaging	1.00
R4357:Rasgrf2	UTSW	13	92,038,796 (GRCm39)	missense	probably damaging	1.00
R4358:Rasgrf2	UTSW	13	92,038,796 (GRCm39)	missense	probably damaging	1.00
R4359:Rasgrf2	UTSW	13	92,038,796 (GRCm39)	missense	probably damaging	1.00
R4439:Rasgrf2	UTSW	13	92,131,797 (GRCm39)	missense	possibly damaging	0.95
R4440:Rasgrf2	UTSW	13	92,131,797 (GRCm39)	missense	possibly damaging	0.95
R4441:Rasgrf2	UTSW	13	92,131,797 (GRCm39)	missense	possibly damaging	0.95
R4564:Rasgrf2	UTSW	13	92,033,773 (GRCm39)	nonsense	probably null
R4576:Rasgrf2	UTSW	13	92,044,529 (GRCm39)	missense	possibly damaging	0.58
R4590:Rasgrf2	UTSW	13	92,174,789 (GRCm39)	missense	probably damaging	1.00
R4718:Rasgrf2	UTSW	13	92,138,716 (GRCm39)	critical splice donor site	probably null
R4778:Rasgrf2	UTSW	13	92,131,780 (GRCm39)	missense	probably damaging	0.99
R4790:Rasgrf2	UTSW	13	92,136,135 (GRCm39)	missense	probably damaging	1.00
R4808:Rasgrf2	UTSW	13	92,160,190 (GRCm39)	missense	probably damaging	1.00
R5151:Rasgrf2	UTSW	13	92,044,155 (GRCm39)	missense	probably damaging	1.00
R5286:Rasgrf2	UTSW	13	92,267,941 (GRCm39)	missense	possibly damaging	0.94
R5902:Rasgrf2	UTSW	13	92,068,011 (GRCm39)	missense	probably damaging	1.00
R6180:Rasgrf2	UTSW	13	92,165,609 (GRCm39)	missense	probably damaging	1.00
R6264:Rasgrf2	UTSW	13	92,167,293 (GRCm39)	missense	probably damaging	1.00
R6369:Rasgrf2	UTSW	13	92,267,954 (GRCm39)	missense	probably benign
R6428:Rasgrf2	UTSW	13	92,136,100 (GRCm39)	missense	probably damaging	1.00
R6595:Rasgrf2	UTSW	13	92,167,361 (GRCm39)	missense	probably damaging	1.00
R6619:Rasgrf2	UTSW	13	92,165,027 (GRCm39)	missense	probably damaging	1.00
R6988:Rasgrf2	UTSW	13	92,033,754 (GRCm39)	missense	probably benign	0.02
R7026:Rasgrf2	UTSW	13	92,131,732 (GRCm39)	missense	probably damaging	1.00
R7038:Rasgrf2	UTSW	13	92,130,952 (GRCm39)	missense	possibly damaging	0.95
R7045:Rasgrf2	UTSW	13	92,159,100 (GRCm39)	intron	probably benign
R7056:Rasgrf2	UTSW	13	92,167,203 (GRCm39)	missense	probably damaging	0.99
R7058:Rasgrf2	UTSW	13	92,034,521 (GRCm39)	missense	probably damaging	0.99
R7256:Rasgrf2	UTSW	13	92,032,637 (GRCm39)	nonsense	probably null
R7392:Rasgrf2	UTSW	13	92,041,856 (GRCm39)	missense
R7469:Rasgrf2	UTSW	13	92,165,530 (GRCm39)	critical splice donor site	probably null
R7618:Rasgrf2	UTSW	13	92,136,085 (GRCm39)	missense
R7641:Rasgrf2	UTSW	13	92,267,914 (GRCm39)	missense	possibly damaging	0.65
R7674:Rasgrf2	UTSW	13	92,267,914 (GRCm39)	missense	possibly damaging	0.65
R7784:Rasgrf2	UTSW	13	92,044,201 (GRCm39)	missense
R7962:Rasgrf2	UTSW	13	92,167,300 (GRCm39)	missense	probably damaging	0.99
R8056:Rasgrf2	UTSW	13	92,167,321 (GRCm39)	missense	probably damaging	0.97
R8218:Rasgrf2	UTSW	13	92,130,796 (GRCm39)	missense
R8796:Rasgrf2	UTSW	13	92,038,685 (GRCm39)	missense
R8913:Rasgrf2	UTSW	13	92,159,034 (GRCm39)	missense	probably benign	0.05
R8971:Rasgrf2	UTSW	13	92,158,225 (GRCm39)	missense	possibly damaging	0.80
R9020:Rasgrf2	UTSW	13	92,165,146 (GRCm39)	missense	possibly damaging	0.93
R9487:Rasgrf2	UTSW	13	92,267,759 (GRCm39)	missense	probably benign
R9562:Rasgrf2	UTSW	13	92,034,469 (GRCm39)	critical splice donor site	probably null
R9712:Rasgrf2	UTSW	13	92,136,092 (GRCm39)	missense
R9766:Rasgrf2	UTSW	13	92,160,188 (GRCm39)	missense	probably damaging	1.00
R9800:Rasgrf2	UTSW	13	92,267,860 (GRCm39)	missense	probably damaging	0.99
X0013:Rasgrf2	UTSW	13	92,167,363 (GRCm39)	missense	probably damaging	1.00
X0026:Rasgrf2	UTSW	13	92,050,654 (GRCm39)	missense	probably damaging	0.99
Z1177:Rasgrf2	UTSW	13	92,159,081 (GRCm39)	missense	unknown
Z1177:Rasgrf2	UTSW	13	92,131,632 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- TGAGCCTAGAATGGATTTGGAGAC -3'
(R):5'- TCTGTGGAGAAGAATGGCTTGAC -3'

Sequencing Primer
(F):5'- CTAGAATGGATTTGGAGACTAGGTTG -3'
(R):5'- TGGAGAAGAATGGCTTGACTTTATAG -3'

Posted On

2014-11-11