Mutagenetix > Incidental Mutation

Incidental Mutation 'R2406:Piezo2'

248032

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Piezo2, 9030411M15Rik, Fam38b2, Fam38b, 9430028L06Rik

MMRRC Submission

040372-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2406 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63143284-63520254 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 63155596 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 2416 (L2416Q)

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047480]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000047480
AA Change: L2416Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: L2416Q

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123322

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132576

Predicted Effect

unknown
Transcript: ENSMUST00000137141
AA Change: L238Q

SMART Domains

Protein: ENSMUSP00000117107
Gene: ENSMUSG00000041482
AA Change: L238Q

Domain	Start	End	E-Value	Type
low complexity region	3	22	N/A	INTRINSIC
transmembrane domain	84	106	N/A	INTRINSIC
transmembrane domain	126	148	N/A	INTRINSIC
transmembrane domain	155	177	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	235	409	4.6e-78	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 93.9%

Validation Efficiency

95% (42/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	A	17: 35,879,352 (GRCm39)	V230E	probably damaging	Het
Adam22	A	T	5: 8,230,064 (GRCm39)		probably benign	Het
AW554918	A	G	18: 25,473,344 (GRCm39)	I180V	possibly damaging	Het
C9	T	C	15: 6,512,780 (GRCm39)	S301P	possibly damaging	Het
Cdc42bpb	T	C	12: 111,268,558 (GRCm39)	Q1214R	probably benign	Het
Chaf1b	T	C	16: 93,697,043 (GRCm39)	I351T	probably damaging	Het
Clip1	T	C	5: 123,741,723 (GRCm39)	E1177G	probably damaging	Het
Colgalt1	G	A	8: 72,070,312 (GRCm39)	C198Y	probably damaging	Het
Dennd4b	C	T	3: 90,182,795 (GRCm39)	R871C	probably damaging	Het
Efcab3	A	T	11: 104,611,457 (GRCm39)	D433V	probably benign	Het
Eif4ebp1	A	G	8: 27,763,362 (GRCm39)	I52V	probably damaging	Het
Fbxw5	T	C	2: 25,394,195 (GRCm39)	I86T	probably damaging	Het
Gm10650	A	G	3: 127,833,530 (GRCm39)		noncoding transcript	Het
Helz	G	A	11: 107,577,378 (GRCm39)	A1910T	unknown	Het
Hsf2	C	T	10: 57,373,642 (GRCm39)	T70I	probably damaging	Het
Ifih1	A	G	2: 62,437,447 (GRCm39)		probably benign	Het
Kdm2a	T	C	19: 4,372,546 (GRCm39)	D933G	probably damaging	Het
Macc1	T	C	12: 119,429,346 (GRCm39)	I832T	probably damaging	Het
Mapk15	T	C	15: 75,870,697 (GRCm39)	S512P	possibly damaging	Het
Mybpc2	A	T	7: 44,171,149 (GRCm39)	I134N	possibly damaging	Het
Myh4	A	G	11: 67,150,000 (GRCm39)	E1853G	probably damaging	Het
Ncoa3	T	C	2: 165,897,279 (GRCm39)	V690A	probably damaging	Het
Nsf	C	T	11: 103,821,578 (GRCm39)	E26K	possibly damaging	Het
Or5b97	A	G	19: 12,878,991 (GRCm39)	V51A	probably benign	Het
Pacsin2	A	T	15: 83,269,313 (GRCm39)		probably benign	Het
Pip5k1c	T	A	10: 81,144,858 (GRCm39)	I233N	probably damaging	Het
Ptcd3	T	C	6: 71,865,631 (GRCm39)	D428G	probably damaging	Het
Ptprf	T	C	4: 118,126,501 (GRCm39)	D84G	possibly damaging	Het
Rasgrf2	T	C	13: 92,120,359 (GRCm39)	D798G	probably benign	Het
Setd7	A	G	3: 51,450,097 (GRCm39)	Y110H	probably damaging	Het
Sgta	T	C	10: 80,887,081 (GRCm39)	I61M	possibly damaging	Het
Shank1	A	G	7: 44,006,376 (GRCm39)	D2031G	possibly damaging	Het
Skint5	A	G	4: 113,799,864 (GRCm39)	Y88H	probably damaging	Het
Spata31f1a	A	T	4: 42,851,696 (GRCm39)	D153E	probably benign	Het
Stox1	T	C	10: 62,499,945 (GRCm39)	I872V	probably benign	Het
Tmc4	A	G	7: 3,674,025 (GRCm39)	F385L	probably benign	Het
Top3a	A	G	11: 60,646,838 (GRCm39)	F258L	probably damaging	Het
Ttn	T	C	2: 76,780,499 (GRCm39)	Y1084C	probably damaging	Het
Ubtf	A	T	11: 102,199,528 (GRCm39)	Y504*	probably null	Het
Wdfy3	T	C	5: 102,036,125 (GRCm39)	T2098A	probably damaging	Het
Wnk2	G	T	13: 49,214,964 (GRCm39)	T1194K	possibly damaging	Het
Zbtb40	T	A	4: 136,725,879 (GRCm39)	E560V	probably benign	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63,250,770 (GRCm39)	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63,155,531 (GRCm39)	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63,203,101 (GRCm39)	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63,257,685 (GRCm39)	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63,163,463 (GRCm39)	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63,315,904 (GRCm39)	splice site	probably benign
IGL01674:Piezo2	APN	18	63,160,630 (GRCm39)	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63,216,241 (GRCm39)	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63,175,859 (GRCm39)	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63,225,915 (GRCm39)	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63,153,705 (GRCm39)	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63,279,915 (GRCm39)	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63,205,933 (GRCm39)	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63,165,995 (GRCm39)	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63,157,546 (GRCm39)	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63,207,730 (GRCm39)	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63,153,704 (GRCm39)	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63,153,704 (GRCm39)	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63,197,856 (GRCm39)	splice site	probably benign
IGL03011:Piezo2	APN	18	63,257,731 (GRCm39)	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63,203,146 (GRCm39)	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63,163,343 (GRCm39)	splice site	probably null
IGL03129:Piezo2	APN	18	63,248,043 (GRCm39)	missense	probably benign
IGL03143:Piezo2	APN	18	63,241,147 (GRCm39)	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63,144,669 (GRCm39)	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63,257,677 (GRCm39)	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63,186,133 (GRCm39)	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63,174,791 (GRCm39)	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63,144,609 (GRCm39)	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63,154,379 (GRCm39)	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63,160,775 (GRCm39)	missense	probably damaging	1.00
Piccolo	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
sopranino	UTSW	18	63,157,537 (GRCm39)	missense	probably damaging	1.00
woodwind	UTSW	18	63,257,713 (GRCm39)	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63,519,271 (GRCm39)	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63,157,540 (GRCm39)	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63,235,155 (GRCm39)	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63,157,562 (GRCm39)	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63,162,132 (GRCm39)	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63,235,245 (GRCm39)	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63,157,522 (GRCm39)	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63,160,615 (GRCm39)	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63,155,552 (GRCm39)	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63,155,497 (GRCm39)	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63,152,329 (GRCm39)	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63,174,794 (GRCm39)	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63,216,306 (GRCm39)	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63,148,873 (GRCm39)	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63,219,824 (GRCm39)	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63,154,325 (GRCm39)	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63,216,202 (GRCm39)	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63,277,990 (GRCm39)	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63,215,986 (GRCm39)	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63,250,743 (GRCm39)	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63,154,244 (GRCm39)	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63,257,713 (GRCm39)	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63,239,355 (GRCm39)	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63,241,158 (GRCm39)	missense	probably damaging	1.00
R1799:Piezo2	UTSW	18	63,165,911 (GRCm39)	critical splice donor site	probably null
R1868:Piezo2	UTSW	18	63,152,415 (GRCm39)	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63,247,031 (GRCm39)	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63,211,911 (GRCm39)	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63,207,733 (GRCm39)	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63,207,733 (GRCm39)	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63,207,733 (GRCm39)	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63,211,852 (GRCm39)	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63,277,997 (GRCm39)	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63,192,815 (GRCm39)	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63,252,006 (GRCm39)	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63,214,805 (GRCm39)	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63,250,791 (GRCm39)	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63,247,112 (GRCm39)	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63,214,733 (GRCm39)	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63,239,345 (GRCm39)	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63,278,143 (GRCm39)	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63,278,143 (GRCm39)	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63,378,695 (GRCm39)	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63,186,106 (GRCm39)	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63,279,914 (GRCm39)	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63,157,506 (GRCm39)	nonsense	probably null
R3016:Piezo2	UTSW	18	63,175,903 (GRCm39)	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63,214,864 (GRCm39)	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63,214,733 (GRCm39)	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63,214,733 (GRCm39)	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63,183,675 (GRCm39)	missense	probably benign
R4181:Piezo2	UTSW	18	63,257,801 (GRCm39)	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63,217,911 (GRCm39)	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63,257,801 (GRCm39)	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63,235,170 (GRCm39)	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63,247,134 (GRCm39)	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63,205,951 (GRCm39)	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63,219,699 (GRCm39)	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63,203,034 (GRCm39)	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63,163,472 (GRCm39)	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63,163,472 (GRCm39)	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63,278,025 (GRCm39)	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63,211,862 (GRCm39)	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63,290,333 (GRCm39)	missense	probably benign
R4961:Piezo2	UTSW	18	63,186,032 (GRCm39)	splice site	probably null
R4968:Piezo2	UTSW	18	63,278,042 (GRCm39)	nonsense	probably null
R4973:Piezo2	UTSW	18	63,207,751 (GRCm39)	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63,216,184 (GRCm39)	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63,157,607 (GRCm39)	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63,207,691 (GRCm39)	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63,163,480 (GRCm39)	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63,166,000 (GRCm39)	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63,197,802 (GRCm39)	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63,217,811 (GRCm39)	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63,278,176 (GRCm39)	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63,160,935 (GRCm39)	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63,144,792 (GRCm39)	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63,278,162 (GRCm39)	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63,250,768 (GRCm39)	missense	probably benign	0.25
R5677:Piezo2	UTSW	18	63,250,767 (GRCm39)	missense	possibly damaging	0.94
R5792:Piezo2	UTSW	18	63,279,927 (GRCm39)	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63,160,972 (GRCm39)	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63,247,005 (GRCm39)	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63,248,019 (GRCm39)	nonsense	probably null
R6036:Piezo2	UTSW	18	63,248,019 (GRCm39)	nonsense	probably null
R6073:Piezo2	UTSW	18	63,145,716 (GRCm39)	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63,290,281 (GRCm39)	nonsense	probably null
R6255:Piezo2	UTSW	18	63,254,341 (GRCm39)	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63,250,749 (GRCm39)	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63,239,364 (GRCm39)	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63,219,678 (GRCm39)	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63,174,734 (GRCm39)	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63,239,342 (GRCm39)	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63,154,399 (GRCm39)	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63,154,333 (GRCm39)	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63,165,960 (GRCm39)	nonsense	probably null
R6855:Piezo2	UTSW	18	63,223,950 (GRCm39)	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63,166,057 (GRCm39)	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63,216,032 (GRCm39)	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63,278,181 (GRCm39)	nonsense	probably null
R7162:Piezo2	UTSW	18	63,257,780 (GRCm39)	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63,241,101 (GRCm39)	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63,150,590 (GRCm39)	splice site	probably null
R7395:Piezo2	UTSW	18	63,160,634 (GRCm39)	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63,157,543 (GRCm39)	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63,145,794 (GRCm39)	missense	probably benign
R7517:Piezo2	UTSW	18	63,215,996 (GRCm39)	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63,186,081 (GRCm39)	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63,175,610 (GRCm39)	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63,246,947 (GRCm39)	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63,216,016 (GRCm39)	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63,216,271 (GRCm39)	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63,175,882 (GRCm39)	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63,163,537 (GRCm39)	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63,208,801 (GRCm39)	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63,145,857 (GRCm39)	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63,224,069 (GRCm39)	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63,217,759 (GRCm39)	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63,224,069 (GRCm39)	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63,178,611 (GRCm39)	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63,279,873 (GRCm39)	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63,225,971 (GRCm39)	nonsense	probably null
R8708:Piezo2	UTSW	18	63,226,086 (GRCm39)	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63,242,956 (GRCm39)	missense	probably benign
R8727:Piezo2	UTSW	18	63,242,956 (GRCm39)	missense	probably benign
R8810:Piezo2	UTSW	18	63,248,034 (GRCm39)	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63,248,096 (GRCm39)	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63,225,902 (GRCm39)	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63,157,537 (GRCm39)	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63,208,790 (GRCm39)	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63,163,450 (GRCm39)	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63,178,589 (GRCm39)	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63,178,589 (GRCm39)	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63,178,550 (GRCm39)	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63,250,815 (GRCm39)	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63,290,302 (GRCm39)	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63,154,372 (GRCm39)	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63,208,868 (GRCm39)	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63,163,450 (GRCm39)	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63,208,790 (GRCm39)	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63,157,637 (GRCm39)	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63,162,156 (GRCm39)	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63,166,033 (GRCm39)	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63,235,236 (GRCm39)	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63,166,033 (GRCm39)	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63,519,347 (GRCm39)	start gained	probably benign
R9608:Piezo2	UTSW	18	63,280,016 (GRCm39)	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63,248,108 (GRCm39)	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63,197,767 (GRCm39)	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63,160,657 (GRCm39)	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63,183,681 (GRCm39)	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63,150,648 (GRCm39)	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63,203,065 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACAAGCCATGCAGTATCCATG -3'
(R):5'- AGCAGTTGTGTTCCCAGTTG -3'

Sequencing Primer
(F):5'- GTTAATCTTGTAACAGACCTGCGC -3'
(R):5'- CCAGTTGGGTTTCACTGTGAG -3'

Posted On

2014-11-11