Incidental Mutation 'R2407:Togaram1'
ID248067
Institutional Source Beutler Lab
Gene Symbol Togaram1
Ensembl Gene ENSMUSG00000035614
Gene NameTOG array regulator of axonemal microtubules 1
SynonymsFam179b, A430041B07Rik
MMRRC Submission 040373-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.737) question?
Stock #R2407 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location64965804-65022573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64967670 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 565 (M565T)
Ref Sequence ENSEMBL: ENSMUSP00000070382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021331] [ENSMUST00000066296] [ENSMUST00000222508] [ENSMUST00000223166]
Predicted Effect probably benign
Transcript: ENSMUST00000021331
SMART Domains Protein: ENSMUSP00000021331
Gene: ENSMUSG00000020948

DomainStartEndE-ValueType
BTB 35 132 3.55e-30 SMART
BACK 137 239 1.83e-36 SMART
Kelch 284 331 3.52e-4 SMART
Kelch 332 386 4.23e-7 SMART
Kelch 387 433 1.99e-12 SMART
Kelch 434 479 1.64e-13 SMART
Kelch 480 526 5.12e-15 SMART
Kelch 527 571 5.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066296
AA Change: M565T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070382
Gene: ENSMUSG00000035614
AA Change: M565T

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
TOG 339 574 3.38e-23 SMART
low complexity region 804 815 N/A INTRINSIC
low complexity region 988 1001 N/A INTRINSIC
low complexity region 1011 1024 N/A INTRINSIC
low complexity region 1033 1041 N/A INTRINSIC
coiled coil region 1177 1206 N/A INTRINSIC
TOG 1251 1486 4.37e-8 SMART
TOG 1533 1776 1.53e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000221836
AA Change: M538T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221957
Predicted Effect probably benign
Transcript: ENSMUST00000222508
Predicted Effect probably damaging
Transcript: ENSMUST00000223166
AA Change: M565T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik A T 6: 65,953,228 N149I probably benign Het
4931408C20Rik A T 1: 26,682,838 M1087K possibly damaging Het
Agxt G T 1: 93,135,780 A135S probably benign Het
Aldh1a2 A T 9: 71,252,598 I40F probably damaging Het
Ang T A 14: 51,101,646 C81* probably null Het
Apc G T 18: 34,314,262 V1370F possibly damaging Het
Arfgef3 T C 10: 18,677,866 T127A possibly damaging Het
Cd1d1 A G 3: 86,998,182 L168P probably damaging Het
Epb42 C A 2: 121,024,752 V451F probably damaging Het
F5 T A 1: 164,211,872 L2017Q probably damaging Het
Hmcn2 A T 2: 31,335,412 probably null Het
Kif13a G A 13: 46,777,097 P164S probably damaging Het
Kirrel T A 3: 87,084,843 I593F probably benign Het
Lin28b A T 10: 45,381,087 I265N possibly damaging Het
Mctp2 A T 7: 72,200,407 D507E probably benign Het
Morc3 G A 16: 93,844,327 probably null Het
Myo3b T C 2: 70,255,253 Y750H probably damaging Het
Nrp1 T C 8: 128,431,945 S238P probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Otog A G 7: 46,241,540 E41G probably benign Het
Pclo G T 5: 14,678,932 probably benign Het
Pdzd2 T C 15: 12,373,161 D2296G probably damaging Het
Peak1 A G 9: 56,259,226 C473R probably damaging Het
Rad51ap2 T A 12: 11,458,501 M808K probably damaging Het
Sec24b A C 3: 130,002,316 S651A probably benign Het
Slc17a3 G A 13: 23,852,435 probably null Het
Slc4a10 A G 2: 62,313,343 H1074R probably benign Het
Spata31d1b A G 13: 59,716,846 K603E possibly damaging Het
Sptbn4 T A 7: 27,418,098 K409* probably null Het
Tacc2 G A 7: 130,622,040 V152I possibly damaging Het
Tiam2 A G 17: 3,477,261 M65V probably benign Het
Tmem131l G T 3: 83,922,048 Q1100K probably benign Het
Trib1 T C 15: 59,654,600 Y340H probably benign Het
Wdr66 A T 5: 123,289,969 M510L probably benign Het
Wdr7 A T 18: 63,760,723 M643L probably benign Het
Zfp51 A T 17: 21,463,831 H236L probably damaging Het
Other mutations in Togaram1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Togaram1 APN 12 65006399 missense probably damaging 1.00
IGL01128:Togaram1 APN 12 64980876 missense probably benign 0.01
IGL01406:Togaram1 APN 12 64995578 missense possibly damaging 0.81
IGL01534:Togaram1 APN 12 64966547 missense probably damaging 0.99
IGL01569:Togaram1 APN 12 64982662 missense possibly damaging 0.81
IGL01927:Togaram1 APN 12 64976702 missense probably benign 0.31
IGL02066:Togaram1 APN 12 64983421 missense probably damaging 1.00
IGL02746:Togaram1 APN 12 64966496 nonsense probably null
IGL02878:Togaram1 APN 12 64992626 missense possibly damaging 0.60
IGL02947:Togaram1 APN 12 65021500 missense probably damaging 1.00
IGL02961:Togaram1 APN 12 64966710 missense probably damaging 1.00
PIT4810001:Togaram1 UTSW 12 64983512 missense probably damaging 1.00
R0483:Togaram1 UTSW 12 65007031 missense probably damaging 1.00
R0519:Togaram1 UTSW 12 64966002 unclassified probably benign
R0584:Togaram1 UTSW 12 64967505 missense probably damaging 1.00
R0646:Togaram1 UTSW 12 65021466 missense probably damaging 1.00
R0749:Togaram1 UTSW 12 64982698 missense possibly damaging 0.87
R0891:Togaram1 UTSW 12 64982647 missense probably benign 0.01
R1111:Togaram1 UTSW 12 65006341 missense probably damaging 1.00
R1349:Togaram1 UTSW 12 65011145 missense probably damaging 0.99
R1531:Togaram1 UTSW 12 64966265 missense probably benign 0.01
R1618:Togaram1 UTSW 12 64967073 missense possibly damaging 0.47
R1672:Togaram1 UTSW 12 65021568 missense probably benign 0.00
R1789:Togaram1 UTSW 12 65002635 missense possibly damaging 0.47
R1822:Togaram1 UTSW 12 64995635 missense probably damaging 0.98
R1930:Togaram1 UTSW 12 64966935 missense probably damaging 1.00
R1931:Togaram1 UTSW 12 64966935 missense probably damaging 1.00
R2006:Togaram1 UTSW 12 65019140 missense probably damaging 1.00
R2018:Togaram1 UTSW 12 65002659 missense possibly damaging 0.76
R2304:Togaram1 UTSW 12 64976856 splice site probably null
R2345:Togaram1 UTSW 12 65008632 missense probably benign 0.05
R2853:Togaram1 UTSW 12 65016612 missense probably benign 0.40
R3123:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3124:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3125:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3693:Togaram1 UTSW 12 64983509 missense probably benign 0.34
R3857:Togaram1 UTSW 12 64980859 missense possibly damaging 0.64
R3870:Togaram1 UTSW 12 65002645 missense probably benign 0.00
R3871:Togaram1 UTSW 12 65002645 missense probably benign 0.00
R4398:Togaram1 UTSW 12 64980856 missense probably benign
R4578:Togaram1 UTSW 12 65020326 missense probably damaging 1.00
R4579:Togaram1 UTSW 12 64967907 missense probably damaging 1.00
R4621:Togaram1 UTSW 12 64982450 missense possibly damaging 0.87
R4623:Togaram1 UTSW 12 64982450 missense possibly damaging 0.87
R4655:Togaram1 UTSW 12 64967120 missense possibly damaging 0.91
R5080:Togaram1 UTSW 12 64983403 missense probably benign 0.02
R5459:Togaram1 UTSW 12 64967736 missense probably damaging 1.00
R5652:Togaram1 UTSW 12 65016650 missense probably benign 0.13
R5857:Togaram1 UTSW 12 64995557 missense possibly damaging 0.64
R5997:Togaram1 UTSW 12 64995538 missense probably benign 0.00
R6090:Togaram1 UTSW 12 64967801 missense probably benign 0.07
R6117:Togaram1 UTSW 12 64967487 missense probably damaging 1.00
R6221:Togaram1 UTSW 12 64966546 missense probably damaging 1.00
R6505:Togaram1 UTSW 12 64966590 missense possibly damaging 0.78
R6545:Togaram1 UTSW 12 64978207 missense possibly damaging 0.90
R6706:Togaram1 UTSW 12 65002609 missense probably benign 0.16
R7041:Togaram1 UTSW 12 65020386 missense possibly damaging 0.76
R7199:Togaram1 UTSW 12 64995518 missense probably benign
R7284:Togaram1 UTSW 12 65008680 missense probably benign 0.09
R7451:Togaram1 UTSW 12 64996975 missense probably damaging 1.00
X0021:Togaram1 UTSW 12 64966184 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGGATTTTGACTTACCCAAACTG -3'
(R):5'- AAAGTTGCATGCTGTCCCTG -3'

Sequencing Primer
(F):5'- GACTTACCCAAACTGTCCTTTG -3'
(R):5'- TCACCACAGTAGCAGTGTG -3'
Posted On2014-11-11