Incidental Mutation 'R2408:Hhipl1'
ID248107
Institutional Source Beutler Lab
Gene Symbol Hhipl1
Ensembl Gene ENSMUSG00000021260
Gene Namehedgehog interacting protein-like 1
Synonyms
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2408 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location108306270-108330869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108318547 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 386 (D386E)
Ref Sequence ENSEMBL: ENSMUSP00000021685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021685]
Predicted Effect probably benign
Transcript: ENSMUST00000021685
AA Change: D386E

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000021685
Gene: ENSMUSG00000021260
AA Change: D386E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Folate_rec 28 189 2.4e-21 PFAM
Pfam:GSDH 199 532 3e-39 PFAM
low complexity region 619 670 N/A INTRINSIC
SR 682 785 2.01e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223395
Meta Mutation Damage Score 0.1952 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glucose/sorbosone dehydrogenase family. The encoded protein also contains a domain that binds folate and reduced folic acid derivatives. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,003,493 L103V probably null Het
BC051076 C T 5: 87,963,825 noncoding transcript Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Dusp7 C T 9: 106,369,162 A122V probably benign Het
Exd2 T G 12: 80,484,241 probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Fam69a T C 5: 107,914,425 D78G possibly damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hnf1a C T 5: 114,960,011 probably null Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Med26 T C 8: 72,495,632 D541G probably benign Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Msh5 T C 17: 35,045,119 D136G probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Noct T C 3: 51,225,289 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prmt2 A T 10: 76,208,467 M417K probably damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Tmem222 T C 4: 133,271,024 H73R possibly damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Ucn3 T G 13: 3,941,413 I80L probably benign Het
Vwa3a T C 7: 120,773,294 S302P probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Zmynd19 A G 2: 24,958,925 E144G possibly damaging Het
Other mutations in Hhipl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
lemon_drops UTSW 12 108311944 missense probably damaging 1.00
rock_candy UTSW 12 108311689 missense probably damaging 1.00
R0091:Hhipl1 UTSW 12 108321897 splice site probably benign
R0180:Hhipl1 UTSW 12 108328070 missense probably damaging 1.00
R0610:Hhipl1 UTSW 12 108319402 nonsense probably null
R0962:Hhipl1 UTSW 12 108327721 missense probably benign 0.02
R1170:Hhipl1 UTSW 12 108311693 nonsense probably null
R1474:Hhipl1 UTSW 12 108311737 missense probably damaging 1.00
R1878:Hhipl1 UTSW 12 108320060 missense possibly damaging 0.93
R2001:Hhipl1 UTSW 12 108321859 missense possibly damaging 0.90
R2103:Hhipl1 UTSW 12 108327718 missense probably benign 0.04
R2132:Hhipl1 UTSW 12 108311690 missense probably damaging 1.00
R2342:Hhipl1 UTSW 12 108318462 missense probably damaging 1.00
R3431:Hhipl1 UTSW 12 108311689 missense probably damaging 1.00
R3432:Hhipl1 UTSW 12 108311689 missense probably damaging 1.00
R3741:Hhipl1 UTSW 12 108318717 missense probably damaging 1.00
R3802:Hhipl1 UTSW 12 108312307 missense probably benign
R4744:Hhipl1 UTSW 12 108319979 missense possibly damaging 0.95
R4760:Hhipl1 UTSW 12 108320077 missense probably damaging 0.99
R4927:Hhipl1 UTSW 12 108311944 missense probably damaging 1.00
R5206:Hhipl1 UTSW 12 108312178 missense probably damaging 1.00
R5244:Hhipl1 UTSW 12 108312134 missense probably damaging 0.99
R5292:Hhipl1 UTSW 12 108327778 missense probably benign
R5445:Hhipl1 UTSW 12 108328208 missense probably damaging 0.97
R6248:Hhipl1 UTSW 12 108318705 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCTGTGCAAGTGGTTGAG -3'
(R):5'- TCCGGGACAGATCTAGCTAAGG -3'

Sequencing Primer
(F):5'- TTGAGCAGGGCTGAACTCG -3'
(R):5'- TTGCGGTCGTAGCACTCGAAG -3'
Posted On2014-11-11