Incidental Mutation 'R2408:Msh5'
ID248113
Institutional Source Beutler Lab
Gene Symbol Msh5
Ensembl Gene ENSMUSG00000007035
Gene NamemutS homolog 5
SynonymsMut5, G7
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2408 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35028605-35046745 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35045119 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 136 (D136G)
Ref Sequence ENSEMBL: ENSMUSP00000134426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007250] [ENSMUST00000007257] [ENSMUST00000097338] [ENSMUST00000172491] [ENSMUST00000172536] [ENSMUST00000174556] [ENSMUST00000174603]
Predicted Effect probably damaging
Transcript: ENSMUST00000007250
AA Change: D136G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000007250
Gene: ENSMUSG00000007035
AA Change: D136G

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
MUTSac 584 775 2.2e-61 SMART
Blast:MUTSac 795 833 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000007257
SMART Domains Protein: ENSMUSP00000007257
Gene: ENSMUSG00000007041

DomainStartEndE-ValueType
Pfam:GST_N_3 21 92 4.8e-11 PFAM
Pfam:GST_N_2 23 87 3.3e-10 PFAM
Pfam:GST_C_2 123 212 3.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097338
AA Change: D136G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000094951
Gene: ENSMUSG00000007035
AA Change: D136G

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
MUTSac 584 775 2.2e-61 SMART
Blast:MUTSac 795 833 3e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165329
Predicted Effect probably benign
Transcript: ENSMUST00000172491
SMART Domains Protein: ENSMUSP00000133415
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172536
AA Change: D136G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134426
Gene: ENSMUSG00000007035
AA Change: D136G

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
low complexity region 604 615 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173928
Predicted Effect probably benign
Transcript: ENSMUST00000174556
SMART Domains Protein: ENSMUSP00000134061
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174603
AA Change: D136G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134065
Gene: ENSMUSG00000007035
AA Change: D136G

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 493 1.67e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174741
SMART Domains Protein: ENSMUSP00000133997
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
Blast:MUTSd 106 140 1e-8 BLAST
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: This gene encodes a member of the MutS family of proteins that play critical roles in DNA mismatch repair and meiotic homologous recombination processes. Mice lacking the encoded protein are viable but sterile, with severe defects in spermatogenesis in males and complete loss of ovarian structures in females. Mutations in a similar gene in humans have been shown to cause common variable immune deficiency (CVID) and immunoglobulin A deficiency. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disrupted chromosome pairing in meiosis I resulting in cell death and sterility. In males, testes size is reduced, and in females, there is a total loss of ovarian structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,003,493 L103V probably null Het
BC051076 C T 5: 87,963,825 noncoding transcript Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Dusp7 C T 9: 106,369,162 A122V probably benign Het
Exd2 T G 12: 80,484,241 probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Fam69a T C 5: 107,914,425 D78G possibly damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hhipl1 T A 12: 108,318,547 D386E probably benign Het
Hnf1a C T 5: 114,960,011 probably null Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Med26 T C 8: 72,495,632 D541G probably benign Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Noct T C 3: 51,225,289 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prmt2 A T 10: 76,208,467 M417K probably damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Tmem222 T C 4: 133,271,024 H73R possibly damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Ucn3 T G 13: 3,941,413 I80L probably benign Het
Vwa3a T C 7: 120,773,294 S302P probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Zmynd19 A G 2: 24,958,925 E144G possibly damaging Het
Other mutations in Msh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Msh5 APN 17 35029881 nonsense probably null
IGL00491:Msh5 APN 17 35030730 missense probably damaging 0.96
IGL01364:Msh5 APN 17 35028769 missense possibly damaging 0.70
R0189:Msh5 UTSW 17 35029654 missense probably null 0.97
R0257:Msh5 UTSW 17 35032864 missense probably damaging 0.99
R0346:Msh5 UTSW 17 35029888 missense probably benign 0.09
R0449:Msh5 UTSW 17 35041482 missense probably benign 0.09
R0645:Msh5 UTSW 17 35039223 missense probably damaging 1.00
R1925:Msh5 UTSW 17 35029952 missense probably benign 0.00
R1929:Msh5 UTSW 17 35044390 missense probably benign 0.24
R1970:Msh5 UTSW 17 35033600 missense probably damaging 0.99
R2025:Msh5 UTSW 17 35032792 missense possibly damaging 0.90
R2038:Msh5 UTSW 17 35046040 missense probably benign 0.12
R2058:Msh5 UTSW 17 35029756 missense probably damaging 0.99
R2271:Msh5 UTSW 17 35044390 missense probably benign 0.24
R3079:Msh5 UTSW 17 35046232 missense probably benign 0.41
R4409:Msh5 UTSW 17 35039250 missense probably damaging 0.98
R4513:Msh5 UTSW 17 35030688 missense possibly damaging 0.89
R4878:Msh5 UTSW 17 35038456 missense probably damaging 1.00
R4951:Msh5 UTSW 17 35038420 nonsense probably null
R5037:Msh5 UTSW 17 35032393 missense possibly damaging 0.80
R5063:Msh5 UTSW 17 35042188 splice site probably null
R5064:Msh5 UTSW 17 35043783 intron probably benign
R5103:Msh5 UTSW 17 35029239 missense possibly damaging 0.96
R5872:Msh5 UTSW 17 35029652 critical splice donor site probably null
R6320:Msh5 UTSW 17 35029924 missense probably damaging 0.97
R6869:Msh5 UTSW 17 35041834 intron probably null
R6997:Msh5 UTSW 17 35030002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTTTGGCTCCAACGTTC -3'
(R):5'- ACTCGATTTCTAGGGAAGCTTGG -3'

Sequencing Primer
(F):5'- TTGGCTCCAACGTTCAAAACTG -3'
(R):5'- CTAGGGAAGCTTGGTAAGGATTGC -3'
Posted On2014-11-11