Mutagenetix > Incidental Mutation

Incidental Mutation 'R2373:Ahctf1'

248191

Institutional Source

Beutler Lab

Gene Symbol

Ahctf1

Ensembl Gene

ENSMUSG00000026491

Gene Name

AT hook containing transcription factor 1

Synonyms

Elys, 6230412P20Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2373 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

179572459-179631245 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 179623361 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 86 (F86I)

Ref Sequence

ENSEMBL: ENSMUSP00000027768 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027768]

AlphaFold

Q8CJF7

PDB Structure

Nucleoporin ELYS (aa1-494), Mus musculus [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027768
AA Change: F86I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027768
Gene: ENSMUSG00000026491
AA Change: F86I

Domain	Start	End	E-Value	Type
Pfam:ELYS-bb	1	489	1.6e-307	PFAM
Pfam:ELYS	722	955	2.5e-58	PFAM
low complexity region	1138	1155	N/A	INTRINSIC
low complexity region	1180	1192	N/A	INTRINSIC
low complexity region	1352	1366	N/A	INTRINSIC
low complexity region	1597	1610	N/A	INTRINSIC
low complexity region	1684	1694	N/A	INTRINSIC
low complexity region	1834	1841	N/A	INTRINSIC
low complexity region	1918	1935	N/A	INTRINSIC
AT_hook	1955	1967	3.35e-1	SMART
low complexity region	2060	2066	N/A	INTRINSIC
low complexity region	2073	2084	N/A	INTRINSIC
low complexity region	2096	2108	N/A	INTRINSIC
Blast:KISc	2164	2217	2e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147137

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192645

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194536

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 93.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice die between E3.5 and E5.5. The inner cell mass cells exhibit impaired proliferation and apoptosis when grown in culture. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,684,980 (GRCm39)	C172*	probably null	Het
9130023H24Rik	A	T	7: 127,836,487 (GRCm39)	D35E	probably benign	Het
9330159F19Rik	A	G	10: 29,101,039 (GRCm39)	N471D	probably benign	Het
Alpk1	T	C	3: 127,473,457 (GRCm39)	T849A	probably benign	Het
Arfgef1	A	T	1: 10,244,367 (GRCm39)	D965E	probably damaging	Het
Asxl1	A	G	2: 153,243,820 (GRCm39)	T1458A	probably benign	Het
Cdc42bpa	A	T	1: 179,939,349 (GRCm39)	M876L	possibly damaging	Het
Celsr3	G	A	9: 108,719,751 (GRCm39)	R2450H	probably benign	Het
Col12a1	A	T	9: 79,564,095 (GRCm39)	V1710E	probably benign	Het
Corin	G	A	5: 72,496,381 (GRCm39)	S524L	probably damaging	Het
Dennd2c	A	G	3: 103,064,158 (GRCm39)	H658R	probably damaging	Het
Disp3	A	G	4: 148,343,252 (GRCm39)	V553A	probably damaging	Het
Dpm2	T	C	2: 32,462,457 (GRCm39)	F81S	probably benign	Het
Emc2	T	A	15: 43,377,154 (GRCm39)	I239N	probably damaging	Het
Fhip1a	C	T	3: 85,583,404 (GRCm39)	W464*	probably null	Het
Fzd5	C	T	1: 64,774,066 (GRCm39)	G565D	probably damaging	Het
Gpld1	T	C	13: 25,146,839 (GRCm39)	F267S	probably benign	Het
Kif14	C	A	1: 136,407,583 (GRCm39)	A46E	probably damaging	Het
Mta3	G	T	17: 84,091,730 (GRCm39)	E179*	probably null	Het
Ninl	T	G	2: 150,822,037 (GRCm39)	T22P	probably damaging	Het
Pcnx2	T	C	8: 126,480,190 (GRCm39)	N2039S	probably damaging	Het
Rc3h2	A	G	2: 37,269,013 (GRCm39)	S818P	possibly damaging	Het
Scn11a	T	A	9: 119,642,252 (GRCm39)	E162D	probably benign	Het
Slc5a7	A	T	17: 54,584,154 (GRCm39)	W379R	probably damaging	Het
Sptb	C	T	12: 76,667,935 (GRCm39)	V721M	probably damaging	Het
Vmn1r82	T	A	7: 12,038,982 (GRCm39)	V85E	probably damaging	Het
Vmn2r130	T	C	17: 23,280,480 (GRCm39)	I47T	possibly damaging	Het
Vmn2r93	T	A	17: 18,518,665 (GRCm39)	F41L	probably benign	Het

Other mutations in Ahctf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00757:Ahctf1	APN	1	179,596,696 (GRCm39)	missense	probably damaging	1.00
IGL01714:Ahctf1	APN	1	179,623,442 (GRCm39)	missense	probably damaging	0.99
IGL01787:Ahctf1	APN	1	179,580,887 (GRCm39)	missense	probably benign
IGL01997:Ahctf1	APN	1	179,583,027 (GRCm39)	missense	probably damaging	0.99
IGL02035:Ahctf1	APN	1	179,593,579 (GRCm39)	missense	probably benign	0.00
IGL02158:Ahctf1	APN	1	179,607,217 (GRCm39)	missense	possibly damaging	0.64
IGL02182:Ahctf1	APN	1	179,580,643 (GRCm39)	missense	probably benign	0.00
IGL02298:Ahctf1	APN	1	179,580,044 (GRCm39)	missense	probably benign	0.00
IGL02325:Ahctf1	APN	1	179,603,580 (GRCm39)	missense	probably benign	0.14
IGL02619:Ahctf1	APN	1	179,620,016 (GRCm39)	missense	possibly damaging	0.90
IGL02858:Ahctf1	APN	1	179,596,599 (GRCm39)	missense	probably damaging	0.96
IGL02893:Ahctf1	APN	1	179,603,576 (GRCm39)	nonsense	probably null
IGL02895:Ahctf1	APN	1	179,621,376 (GRCm39)	missense	probably damaging	1.00
IGL03180:Ahctf1	APN	1	179,602,895 (GRCm39)	critical splice donor site	probably null
IGL03220:Ahctf1	APN	1	179,615,767 (GRCm39)	missense	probably benign	0.01
cerebro	UTSW	1	179,596,979 (GRCm39)	missense	probably damaging	0.99
R0003:Ahctf1	UTSW	1	179,591,038 (GRCm39)	missense	probably benign	0.04
R0024:Ahctf1	UTSW	1	179,580,001 (GRCm39)	missense	probably damaging	0.98
R0030:Ahctf1	UTSW	1	179,580,001 (GRCm39)	missense	probably damaging	0.98
R0432:Ahctf1	UTSW	1	179,611,726 (GRCm39)	missense	probably damaging	0.98
R0481:Ahctf1	UTSW	1	179,587,836 (GRCm39)	missense	probably benign	0.00
R0600:Ahctf1	UTSW	1	179,591,033 (GRCm39)	critical splice donor site	probably null
R0613:Ahctf1	UTSW	1	179,596,979 (GRCm39)	missense	probably damaging	0.99
R0814:Ahctf1	UTSW	1	179,590,473 (GRCm39)	missense	probably benign	0.26
R1055:Ahctf1	UTSW	1	179,591,051 (GRCm39)	missense	possibly damaging	0.46
R1473:Ahctf1	UTSW	1	179,626,844 (GRCm39)	missense	probably damaging	0.99
R1473:Ahctf1	UTSW	1	179,603,673 (GRCm39)	missense	probably benign	0.30
R1689:Ahctf1	UTSW	1	179,595,948 (GRCm39)	missense	probably damaging	0.96
R1778:Ahctf1	UTSW	1	179,580,580 (GRCm39)	missense	possibly damaging	0.57
R1878:Ahctf1	UTSW	1	179,603,074 (GRCm39)	missense	possibly damaging	0.96
R1925:Ahctf1	UTSW	1	179,598,218 (GRCm39)	missense	probably damaging	0.98
R2118:Ahctf1	UTSW	1	179,597,017 (GRCm39)	missense	probably damaging	1.00
R2122:Ahctf1	UTSW	1	179,597,017 (GRCm39)	missense	probably damaging	1.00
R2124:Ahctf1	UTSW	1	179,597,017 (GRCm39)	missense	probably damaging	1.00
R2509:Ahctf1	UTSW	1	179,598,258 (GRCm39)	missense	possibly damaging	0.51
R2697:Ahctf1	UTSW	1	179,580,097 (GRCm39)	missense	probably damaging	0.99
R3035:Ahctf1	UTSW	1	179,581,435 (GRCm39)	missense	probably damaging	1.00
R3155:Ahctf1	UTSW	1	179,583,148 (GRCm39)	missense	probably damaging	0.98
R3899:Ahctf1	UTSW	1	179,605,345 (GRCm39)	missense	possibly damaging	0.95
R4036:Ahctf1	UTSW	1	179,590,181 (GRCm39)	missense	possibly damaging	0.61
R4681:Ahctf1	UTSW	1	179,580,361 (GRCm39)	missense	probably benign	0.27
R4695:Ahctf1	UTSW	1	179,580,619 (GRCm39)	missense	possibly damaging	0.78
R4735:Ahctf1	UTSW	1	179,580,964 (GRCm39)	missense	probably benign	0.00
R4857:Ahctf1	UTSW	1	179,626,922 (GRCm39)	unclassified	probably benign
R4898:Ahctf1	UTSW	1	179,583,077 (GRCm39)	missense	probably benign	0.02
R4905:Ahctf1	UTSW	1	179,576,192 (GRCm39)	missense	probably damaging	1.00
R5011:Ahctf1	UTSW	1	179,611,675 (GRCm39)	missense	possibly damaging	0.92
R5013:Ahctf1	UTSW	1	179,611,675 (GRCm39)	missense	possibly damaging	0.92
R5053:Ahctf1	UTSW	1	179,614,349 (GRCm39)	missense	possibly damaging	0.82
R5207:Ahctf1	UTSW	1	179,621,159 (GRCm39)	intron	probably benign
R5319:Ahctf1	UTSW	1	179,596,615 (GRCm39)	missense	probably damaging	1.00
R5343:Ahctf1	UTSW	1	179,598,199 (GRCm39)	nonsense	probably null
R5546:Ahctf1	UTSW	1	179,581,633 (GRCm39)	missense	probably benign	0.01
R5718:Ahctf1	UTSW	1	179,596,904 (GRCm39)	missense	possibly damaging	0.54
R5862:Ahctf1	UTSW	1	179,615,895 (GRCm39)	missense	probably damaging	1.00
R5958:Ahctf1	UTSW	1	179,574,107 (GRCm39)	unclassified	probably benign
R6010:Ahctf1	UTSW	1	179,623,378 (GRCm39)	missense	possibly damaging	0.80
R6081:Ahctf1	UTSW	1	179,609,237 (GRCm39)	missense	probably benign	0.07
R6093:Ahctf1	UTSW	1	179,590,517 (GRCm39)	missense	probably benign	0.01
R6207:Ahctf1	UTSW	1	179,604,955 (GRCm39)	splice site	probably null
R6268:Ahctf1	UTSW	1	179,591,048 (GRCm39)	missense	probably benign	0.08
R6656:Ahctf1	UTSW	1	179,581,078 (GRCm39)	missense	probably benign	0.05
R6668:Ahctf1	UTSW	1	179,579,972 (GRCm39)	missense	probably benign	0.04
R6788:Ahctf1	UTSW	1	179,580,199 (GRCm39)	missense	probably benign	0.00
R6860:Ahctf1	UTSW	1	179,580,853 (GRCm39)	missense	probably benign	0.04
R6998:Ahctf1	UTSW	1	179,598,480 (GRCm39)	nonsense	probably null
R7082:Ahctf1	UTSW	1	179,602,898 (GRCm39)	missense	probably benign	0.15
R7385:Ahctf1	UTSW	1	179,580,946 (GRCm39)	missense	possibly damaging	0.66
R7414:Ahctf1	UTSW	1	179,611,670 (GRCm39)	missense	probably benign	0.00
R7663:Ahctf1	UTSW	1	179,617,879 (GRCm39)	missense	possibly damaging	0.66
R7673:Ahctf1	UTSW	1	179,590,411 (GRCm39)	missense	probably benign	0.02
R7715:Ahctf1	UTSW	1	179,598,413 (GRCm39)	missense	probably benign	0.00
R7819:Ahctf1	UTSW	1	179,595,880 (GRCm39)	missense	probably benign
R7846:Ahctf1	UTSW	1	179,614,638 (GRCm39)	missense	probably damaging	0.99
R7912:Ahctf1	UTSW	1	179,580,656 (GRCm39)	missense	probably benign	0.00
R7942:Ahctf1	UTSW	1	179,613,660 (GRCm39)	missense	possibly damaging	0.66
R8282:Ahctf1	UTSW	1	179,605,371 (GRCm39)	missense	possibly damaging	0.68
R8376:Ahctf1	UTSW	1	179,610,520 (GRCm39)	missense	probably damaging	0.99
R8439:Ahctf1	UTSW	1	179,590,175 (GRCm39)	missense	possibly damaging	0.89
R8482:Ahctf1	UTSW	1	179,591,107 (GRCm39)	unclassified	probably benign
R8683:Ahctf1	UTSW	1	179,623,321 (GRCm39)	missense	possibly damaging	0.70
R8734:Ahctf1	UTSW	1	179,608,430 (GRCm39)	nonsense	probably null
R8855:Ahctf1	UTSW	1	179,614,341 (GRCm39)	missense	probably damaging	0.99
R8928:Ahctf1	UTSW	1	179,596,626 (GRCm39)	missense	possibly damaging	0.49
R9009:Ahctf1	UTSW	1	179,581,171 (GRCm39)	missense	probably benign	0.11
R9106:Ahctf1	UTSW	1	179,614,601 (GRCm39)	missense	probably benign	0.04
R9228:Ahctf1	UTSW	1	179,611,685 (GRCm39)	missense	probably benign	0.28
R9408:Ahctf1	UTSW	1	179,603,638 (GRCm39)	missense	possibly damaging	0.46
R9800:Ahctf1	UTSW	1	179,581,433 (GRCm39)	missense	possibly damaging	0.77
X0067:Ahctf1	UTSW	1	179,605,269 (GRCm39)	missense	probably damaging	0.99
Z1177:Ahctf1	UTSW	1	179,621,295 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGTGAGCTTTCAGTTTGAAAAGC -3'
(R):5'- CCACGGTGTCCCATAATACC -3'

Sequencing Primer
(F):5'- TTGAAAAGCAAAACTATCAAGGCATC -3'
(R):5'- ACACTGTGCTCTATAAATGCTTTGC -3'

Posted On

2014-11-11