Incidental Mutation 'R2375:Tmco3'
ID248263
Institutional Source Beutler Lab
Gene Symbol Tmco3
Ensembl Gene ENSMUSG00000038497
Gene Nametransmembrane and coiled-coil domains 3
SynonymsB230339H12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2375 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location13288190-13322924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13292059 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 111 (F111S)
Ref Sequence ENSEMBL: ENSMUSP00000040347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045229] [ENSMUST00000045366] [ENSMUST00000110838] [ENSMUST00000110839] [ENSMUST00000110840] [ENSMUST00000203467] [ENSMUST00000203604]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045229
AA Change: F111S

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040347
Gene: ENSMUSG00000038497
AA Change: F111S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
coiled coil region 124 204 N/A INTRINSIC
Pfam:Na_H_Exchanger 274 662 9.2e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045366
SMART Domains Protein: ENSMUSP00000047208
Gene: ENSMUSG00000038506

DomainStartEndE-ValueType
Pfam:UBA_4 9 51 1.5e-13 PFAM
Pfam:Cullin_binding 136 247 2.2e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110838
SMART Domains Protein: ENSMUSP00000106462
Gene: ENSMUSG00000038506

DomainStartEndE-ValueType
Pfam:UBA_4 9 50 9.9e-14 PFAM
PDB:4GAO|G 62 173 3e-71 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110839
SMART Domains Protein: ENSMUSP00000106463
Gene: ENSMUSG00000038506

DomainStartEndE-ValueType
Pfam:UBA_4 9 50 1.1e-13 PFAM
Pfam:Cullin_binding 134 206 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110840
SMART Domains Protein: ENSMUSP00000106464
Gene: ENSMUSG00000038506

DomainStartEndE-ValueType
Pfam:UBA_4 9 50 7.6e-14 PFAM
PDB:4GAO|G 62 199 6e-75 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000203467
SMART Domains Protein: ENSMUSP00000145399
Gene: ENSMUSG00000038506

DomainStartEndE-ValueType
Pfam:UBA_4 9 51 7.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203604
SMART Domains Protein: ENSMUSP00000145430
Gene: ENSMUSG00000038506

DomainStartEndE-ValueType
Pfam:UBA_4 9 51 4.7e-11 PFAM
Pfam:Cullin_binding 136 213 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211645
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Arhgef7 A G 8: 11,814,995 N369S probably benign Het
BC003331 A G 1: 150,390,234 probably null Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cps1 G A 1: 67,217,860 M1312I probably benign Het
Fbn2 A C 18: 58,035,966 I2247S probably damaging Het
Gtf2ird2 T A 5: 134,217,135 L745Q probably benign Het
Lrr1 A G 12: 69,174,923 T280A probably benign Het
Mpig6b C T 17: 35,064,383 M226I probably benign Het
Myo1a A G 10: 127,705,290 D12G probably damaging Het
Olfr802 A G 10: 129,682,163 F192S probably benign Het
Orc5 A G 5: 22,546,552 L71P probably damaging Het
Phc2 T C 4: 128,723,025 S364P probably benign Het
Ramp3 G T 11: 6,676,643 V117L probably benign Het
Rpap1 C A 2: 119,770,407 W836L possibly damaging Het
Syt13 G A 2: 92,946,151 G261D probably benign Het
Taf6 A T 5: 138,182,201 Y300* probably null Het
Thsd7a T C 6: 12,337,362 S1219G probably damaging Het
Upk1b C T 16: 38,787,128 G79E probably damaging Het
Zc3h7b G A 15: 81,792,502 V773M probably benign Het
Zfp655 A G 5: 145,244,396 T355A probably benign Het
Other mutations in Tmco3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Tmco3 APN 8 13292825 missense probably damaging 1.00
IGL01139:Tmco3 APN 8 13319887 missense possibly damaging 0.92
IGL02116:Tmco3 APN 8 13292706 unclassified probably benign
IGL03114:Tmco3 APN 8 13298205 splice site probably benign
Ganado UTSW 8 13292077 unclassified probably null
R0244:Tmco3 UTSW 8 13292037 missense probably damaging 1.00
R0385:Tmco3 UTSW 8 13296027 missense probably damaging 1.00
R0711:Tmco3 UTSW 8 13292039 missense probably damaging 0.96
R1594:Tmco3 UTSW 8 13292052 missense probably damaging 0.98
R1727:Tmco3 UTSW 8 13318866 missense possibly damaging 0.52
R1752:Tmco3 UTSW 8 13291741 missense probably benign
R2850:Tmco3 UTSW 8 13295024 missense probably benign 0.00
R3843:Tmco3 UTSW 8 13296114 splice site probably benign
R4003:Tmco3 UTSW 8 13291959 missense probably damaging 0.96
R4059:Tmco3 UTSW 8 13320848 missense probably benign 0.27
R5071:Tmco3 UTSW 8 13292860 nonsense probably null
R5072:Tmco3 UTSW 8 13292860 nonsense probably null
R5456:Tmco3 UTSW 8 13319815 missense probably damaging 0.96
R5556:Tmco3 UTSW 8 13294870 missense probably damaging 0.99
R5826:Tmco3 UTSW 8 13310314 missense probably damaging 0.99
R6200:Tmco3 UTSW 8 13292077 unclassified probably null
R6586:Tmco3 UTSW 8 13320894 utr 3 prime probably benign
R6858:Tmco3 UTSW 8 13313924 missense probably damaging 1.00
R6867:Tmco3 UTSW 8 13313927 missense probably damaging 1.00
R6944:Tmco3 UTSW 8 13303729 missense probably damaging 1.00
R7082:Tmco3 UTSW 8 13320847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCCACTCAGAGGAAACAG -3'
(R):5'- AGGGGCCCTTCCTAATTCTGTG -3'

Sequencing Primer
(F):5'- AAACAGTGGGCCCTGGAC -3'
(R):5'- GTGTGTTGCTCCACCCCAAC -3'
Posted On2014-11-11