Incidental Mutation 'R2375:Myo1a'
ID248266
Institutional Source Beutler Lab
Gene Symbol Myo1a
Ensembl Gene ENSMUSG00000025401
Gene Namemyosin IA
Synonymsbrush border myosin 1, BBM-I, Myhl
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R2375 (G1)
Quality Score205
Status Not validated
Chromosome10
Chromosomal Location127705170-127720940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127705290 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 12 (D12G)
Ref Sequence ENSEMBL: ENSMUSP00000078540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048099] [ENSMUST00000079590]
Predicted Effect probably benign
Transcript: ENSMUST00000048099
SMART Domains Protein: ENSMUSP00000045988
Gene: ENSMUSG00000040195

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:DUF2215 150 396 1.2e-94 PFAM
low complexity region 416 426 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079590
AA Change: D12G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078540
Gene: ENSMUSG00000025401
AA Change: D12G

DomainStartEndE-ValueType
MYSc 3 695 N/A SMART
IQ 696 718 1.27e-3 SMART
IQ 719 741 1.09e-2 SMART
IQ 742 764 7.52e-6 SMART
Pfam:Myosin_TH1 847 1035 1.4e-42 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional skeletal muscle myosin-1 (MYH1). Unconventional myosins contain the basic domains characteristic of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with autosomal dominant deafness. Alternatively spliced variants have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice display abnormal small intestine brush border morphology, but have normal hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Arhgef7 A G 8: 11,814,995 N369S probably benign Het
BC003331 A G 1: 150,390,234 probably null Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cps1 G A 1: 67,217,860 M1312I probably benign Het
Fbn2 A C 18: 58,035,966 I2247S probably damaging Het
Gtf2ird2 T A 5: 134,217,135 L745Q probably benign Het
Lrr1 A G 12: 69,174,923 T280A probably benign Het
Mpig6b C T 17: 35,064,383 M226I probably benign Het
Olfr802 A G 10: 129,682,163 F192S probably benign Het
Orc5 A G 5: 22,546,552 L71P probably damaging Het
Phc2 T C 4: 128,723,025 S364P probably benign Het
Ramp3 G T 11: 6,676,643 V117L probably benign Het
Rpap1 C A 2: 119,770,407 W836L possibly damaging Het
Syt13 G A 2: 92,946,151 G261D probably benign Het
Taf6 A T 5: 138,182,201 Y300* probably null Het
Thsd7a T C 6: 12,337,362 S1219G probably damaging Het
Tmco3 T C 8: 13,292,059 F111S possibly damaging Het
Upk1b C T 16: 38,787,128 G79E probably damaging Het
Zc3h7b G A 15: 81,792,502 V773M probably benign Het
Zfp655 A G 5: 145,244,396 T355A probably benign Het
Other mutations in Myo1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Myo1a APN 10 127720660 missense probably benign 0.00
IGL01896:Myo1a APN 10 127719904 missense probably benign
IGL02073:Myo1a APN 10 127710225 missense probably damaging 0.98
IGL02380:Myo1a APN 10 127714485 missense probably benign 0.00
IGL02507:Myo1a APN 10 127712609 missense probably damaging 0.98
R0106:Myo1a UTSW 10 127719880 missense probably benign 0.02
R0326:Myo1a UTSW 10 127716297 missense probably benign 0.00
R0357:Myo1a UTSW 10 127710902 missense probably benign 0.02
R0485:Myo1a UTSW 10 127719242 splice site probably benign
R0676:Myo1a UTSW 10 127719880 missense probably benign 0.02
R0707:Myo1a UTSW 10 127719863 unclassified probably benign
R1241:Myo1a UTSW 10 127719279 missense probably benign 0.00
R1441:Myo1a UTSW 10 127719279 missense probably benign 0.00
R1458:Myo1a UTSW 10 127719937 missense probably benign
R1546:Myo1a UTSW 10 127712624 missense probably damaging 1.00
R1692:Myo1a UTSW 10 127719334 synonymous probably null
R1871:Myo1a UTSW 10 127719671 missense probably benign
R2067:Myo1a UTSW 10 127705478 missense probably benign 0.25
R2079:Myo1a UTSW 10 127720613 missense probably benign 0.00
R2151:Myo1a UTSW 10 127720181 missense probably benign 0.18
R3014:Myo1a UTSW 10 127716345 missense probably damaging 1.00
R3741:Myo1a UTSW 10 127714898 missense probably benign 0.19
R3812:Myo1a UTSW 10 127707415 missense possibly damaging 0.89
R4303:Myo1a UTSW 10 127713733 missense probably benign 0.10
R4306:Myo1a UTSW 10 127714081 missense probably benign
R4472:Myo1a UTSW 10 127710458 missense probably benign 0.06
R4599:Myo1a UTSW 10 127720151 unclassified probably null
R4604:Myo1a UTSW 10 127711138 missense probably damaging 1.00
R4649:Myo1a UTSW 10 127710217 missense probably benign 0.05
R4747:Myo1a UTSW 10 127714438 missense probably damaging 1.00
R4755:Myo1a UTSW 10 127715688 missense probably damaging 1.00
R4972:Myo1a UTSW 10 127716309 missense probably benign 0.31
R5072:Myo1a UTSW 10 127707419 critical splice donor site probably null
R5073:Myo1a UTSW 10 127707419 critical splice donor site probably null
R5074:Myo1a UTSW 10 127707419 critical splice donor site probably null
R5386:Myo1a UTSW 10 127705897 nonsense probably null
R5592:Myo1a UTSW 10 127714039 missense probably damaging 1.00
R5619:Myo1a UTSW 10 127718544 missense probably benign 0.00
R6001:Myo1a UTSW 10 127706925 critical splice donor site probably null
R6374:Myo1a UTSW 10 127707680 missense probably damaging 1.00
R6577:Myo1a UTSW 10 127715320 missense possibly damaging 0.94
R6932:Myo1a UTSW 10 127710458 missense probably benign 0.06
R7310:Myo1a UTSW 10 127705828 missense probably damaging 0.98
X0067:Myo1a UTSW 10 127713745 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGACCCTTCTAGTCAGAGGG -3'
(R):5'- ATAGATGGGAAGCTGCTCGTAG -3'

Sequencing Primer
(F):5'- TTCTAGTCAGAGGGCTCTCC -3'
(R):5'- GGGGTTCATTGAGATCACCACATTC -3'
Posted On2014-11-11