Incidental Mutation 'R0302:Lcn2'
ID24831
Institutional Source Beutler Lab
Gene Symbol Lcn2
Ensembl Gene ENSMUSG00000026822
Gene Namelipocalin 2
SynonymsNGAL, 24p3
MMRRC Submission 038514-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0302 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32384633-32388252 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 32384889 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048792] [ENSMUST00000050785] [ENSMUST00000125818] [ENSMUST00000146423] [ENSMUST00000192241]
Predicted Effect probably benign
Transcript: ENSMUST00000048792
SMART Domains Protein: ENSMUSP00000038970
Gene: ENSMUSG00000039195

DomainStartEndE-ValueType
Pfam:UPF0184 1 83 5.5e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050785
SMART Domains Protein: ENSMUSP00000053962
Gene: ENSMUSG00000026822

DomainStartEndE-ValueType
Pfam:Lipocalin 48 195 2.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125818
SMART Domains Protein: ENSMUSP00000117937
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
Blast:ZnF_U1 4 31 3e-6 BLAST
ZnF_U1 33 67 2.08e-1 SMART
ZnF_C2H2 36 60 3.02e0 SMART
low complexity region 96 116 N/A INTRINSIC
ZnF_U1 151 186 1.43e-4 SMART
ZnF_C2H2 154 179 9.56e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144569
Predicted Effect probably benign
Transcript: ENSMUST00000146423
SMART Domains Protein: ENSMUSP00000142021
Gene: ENSMUSG00000039195

DomainStartEndE-ValueType
Pfam:UPF0184 1 43 1.4e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155830
Predicted Effect probably benign
Transcript: ENSMUST00000192241
SMART Domains Protein: ENSMUSP00000141430
Gene: ENSMUSG00000026822

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Pfam:Lipocalin 134 271 5.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192758
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the lipocalin family. Members of this family transport small hydrophobic molecules such as lipids, steroid hormones and retinoids. The protein encoded by this gene is a neutrophil gelatinase-associated lipocalin and plays a role in innate immunity by limiting bacterial growth as a result of sequestering iron-containing siderophores. The presence of this protein in blood and urine is an early biomarker of acute kidney injury. This protein is thought to be be involved in multiple cellular processes, including maintenance of skin homeostasis, and suppression of invasiveness and metastasis. Mice lacking this gene are more susceptible to bacterial infection than wild type mice. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutants are more susceptible to infection with bacteria that utilize enterochelin-type siderophores to acquire iron and impaired thermogenesis. Mice homozygous for another knock-out allele exhibit apoptotic defects in hematopoietic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 T C 4: 126,317,392 E244G probably benign Het
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Ankra2 T A 13: 98,271,692 S216R probably damaging Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Ccdc96 A T 5: 36,486,101 T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Daxx T A 17: 33,913,620 S575T probably damaging Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Epsti1 A T 14: 77,939,926 H182L probably damaging Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Il1rap A G 16: 26,692,794 N196S probably benign Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Itga1 G A 13: 115,012,318 probably benign Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lonp2 A G 8: 86,637,991 T326A possibly damaging Het
Lrpprc T C 17: 84,740,078 I909V possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mfsd6 T C 1: 52,709,457 Y83C probably damaging Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc2a7 C T 4: 150,149,521 A31V probably damaging Het
Slc6a12 A G 6: 121,363,259 D487G probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Ttc7b T C 12: 100,387,179 M390V possibly damaging Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Zfr2 G T 10: 81,251,336 probably benign Het
Other mutations in Lcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00935:Lcn2 APN 2 32387578 critical splice donor site probably null
IGL01327:Lcn2 APN 2 32386018 missense possibly damaging 0.62
IGL01913:Lcn2 APN 2 32387145 missense possibly damaging 0.46
IGL02108:Lcn2 APN 2 32387605 missense probably damaging 0.99
IGL02215:Lcn2 APN 2 32384865 makesense probably null
IGL02577:Lcn2 APN 2 32387089 missense probably damaging 0.97
IGL03129:Lcn2 APN 2 32387704 missense possibly damaging 0.70
R1864:Lcn2 UTSW 2 32385422 missense possibly damaging 0.77
R1865:Lcn2 UTSW 2 32385422 missense possibly damaging 0.77
R4093:Lcn2 UTSW 2 32387716 start codon destroyed probably null 1.00
R4621:Lcn2 UTSW 2 32384643 unclassified probably benign
R5236:Lcn2 UTSW 2 32385961 missense probably benign 0.06
R5716:Lcn2 UTSW 2 32385813 missense possibly damaging 0.88
R6785:Lcn2 UTSW 2 32387027 critical splice donor site probably null
R7059:Lcn2 UTSW 2 32387596 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGGCTCCAGATGCTCCTTGGTATG -3'
(R):5'- TCTGTGACAGTCCTCAGCGATCTC -3'

Sequencing Primer
(F):5'- ATGCTCCTTGGTATGGTGGC -3'
(R):5'- GAGTCCAGATTCCTGTCCAAG -3'
Posted On2013-04-16