Incidental Mutation 'R2377:Dhx32'
ID 248315
Institutional Source Beutler Lab
Gene Symbol Dhx32
Ensembl Gene ENSMUSG00000030986
Gene Name DEAH-box helicase 32 (putative)
Synonyms Ddx32, DEAH (Asp-Glu-Ala-His) box polypeptide 32
MMRRC Submission 040354-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.194) question?
Stock # R2377 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 133322671-133384455 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 133326207 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 407 (H407N)
Ref Sequence ENSEMBL: ENSMUSP00000101745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033282] [ENSMUST00000033290] [ENSMUST00000063669] [ENSMUST00000106139]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033282
SMART Domains Protein: ENSMUSP00000033282
Gene: ENSMUSG00000030983

DomainStartEndE-ValueType
Pfam:BCIP 58 258 2.1e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000033290
AA Change: H547N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033290
Gene: ENSMUSG00000030986
AA Change: H547N

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 597 704 1.7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063669
AA Change: H547N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066067
Gene: ENSMUSG00000030986
AA Change: H547N

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 594 704 4.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106139
AA Change: H407N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101745
Gene: ENSMUSG00000030986
AA Change: H407N

DomainStartEndE-ValueType
Blast:DEXDc 1 113 5e-54 BLAST
SCOP:d1jpna2 1 149 6e-11 SMART
HA2 325 416 3.35e-21 SMART
Pfam:OB_NTP_bind 457 564 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151711
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates 2 transcript variants, but the full length nature of one of the variants has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,285,787 (GRCm39) D1304G probably damaging Het
Adamts10 C A 17: 33,747,866 (GRCm39) H101N probably damaging Het
Apaf1 T A 10: 90,915,755 (GRCm39) K44N possibly damaging Het
Aqr A T 2: 113,971,421 (GRCm39) N471K possibly damaging Het
Blvrb T A 7: 27,159,024 (GRCm39) I94N probably damaging Het
Ccdc38 C T 10: 93,409,897 (GRCm39) P239S probably damaging Het
Chst4 T A 8: 110,756,804 (GRCm39) Y270F possibly damaging Het
Col5a1 T C 2: 27,818,189 (GRCm39) F138S unknown Het
Dock3 G A 9: 106,773,090 (GRCm39) P388S probably damaging Het
Fbxo10 A C 4: 45,044,719 (GRCm39) Y639D probably benign Het
Fsip2 A G 2: 82,806,593 (GRCm39) T971A probably benign Het
Gli2 C T 1: 118,764,855 (GRCm39) A1099T possibly damaging Het
Hr C T 14: 70,795,318 (GRCm39) L317F probably damaging Het
Ice1 G A 13: 70,750,899 (GRCm39) A1729V probably damaging Het
Mcc C G 18: 44,652,616 (GRCm39) K269N probably damaging Het
Miga2 T A 2: 30,274,002 (GRCm39) C83* probably null Het
Msl1 A G 11: 98,694,789 (GRCm39) R273G probably damaging Het
Msl3l2 T C 10: 55,991,659 (GRCm39) I128T probably damaging Het
Ntrk1 T A 3: 87,698,714 (GRCm39) D109V possibly damaging Het
Or14j5 A G 17: 38,161,498 (GRCm39) N5S probably damaging Het
Or4b13 A G 2: 90,083,255 (GRCm39) F26L probably damaging Het
Or4f14b A T 2: 111,774,988 (GRCm39) L271Q probably damaging Het
Or5b97 T A 19: 12,878,217 (GRCm39) Y309F possibly damaging Het
Pcmtd2 A G 2: 181,497,072 (GRCm39) probably benign Het
Polr1a T C 6: 71,949,810 (GRCm39) probably null Het
Ptk2b T A 14: 66,409,997 (GRCm39) I452F possibly damaging Het
Rad21 A G 15: 51,831,834 (GRCm39) F416L probably damaging Het
Scn5a A T 9: 119,368,793 (GRCm39) I244N probably damaging Het
Sla2 G A 2: 156,717,862 (GRCm39) R137C probably damaging Het
Tnpo3 A C 6: 29,579,618 (GRCm39) N258K probably benign Het
Uba6 T C 5: 86,272,229 (GRCm39) D789G possibly damaging Het
Vmn1r226 T G 17: 20,907,992 (GRCm39) L75V probably benign Het
Zfp729b A C 13: 67,739,820 (GRCm39) V815G possibly damaging Het
Other mutations in Dhx32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Dhx32 APN 7 133,350,706 (GRCm39) missense possibly damaging 0.76
IGL03398:Dhx32 APN 7 133,361,254 (GRCm39) missense probably damaging 1.00
R0729:Dhx32 UTSW 7 133,339,150 (GRCm39) missense probably benign 0.01
R1054:Dhx32 UTSW 7 133,327,001 (GRCm39) missense probably damaging 1.00
R1438:Dhx32 UTSW 7 133,339,069 (GRCm39) missense possibly damaging 0.87
R1532:Dhx32 UTSW 7 133,350,753 (GRCm39) missense possibly damaging 0.93
R1864:Dhx32 UTSW 7 133,339,025 (GRCm39) missense probably benign 0.00
R1865:Dhx32 UTSW 7 133,339,025 (GRCm39) missense probably benign 0.00
R2074:Dhx32 UTSW 7 133,323,021 (GRCm39) missense probably benign 0.04
R2075:Dhx32 UTSW 7 133,323,021 (GRCm39) missense probably benign 0.04
R2119:Dhx32 UTSW 7 133,323,976 (GRCm39) nonsense probably null
R3125:Dhx32 UTSW 7 133,327,085 (GRCm39) missense probably damaging 1.00
R4519:Dhx32 UTSW 7 133,335,838 (GRCm39) missense probably damaging 1.00
R4970:Dhx32 UTSW 7 133,340,384 (GRCm39) intron probably benign
R5538:Dhx32 UTSW 7 133,324,946 (GRCm39) missense probably benign
R5616:Dhx32 UTSW 7 133,322,957 (GRCm39) makesense probably null
R5951:Dhx32 UTSW 7 133,339,057 (GRCm39) missense probably damaging 0.98
R6081:Dhx32 UTSW 7 133,323,941 (GRCm39) missense probably damaging 1.00
R6297:Dhx32 UTSW 7 133,344,529 (GRCm39) missense probably damaging 1.00
R6319:Dhx32 UTSW 7 133,338,955 (GRCm39) missense probably damaging 1.00
R7088:Dhx32 UTSW 7 133,344,417 (GRCm39) missense probably damaging 1.00
R7257:Dhx32 UTSW 7 133,361,206 (GRCm39) missense probably benign 0.08
R7686:Dhx32 UTSW 7 133,361,430 (GRCm39) start codon destroyed probably null
R7952:Dhx32 UTSW 7 133,350,725 (GRCm39) missense probably benign 0.30
R8025:Dhx32 UTSW 7 133,323,100 (GRCm39) missense probably damaging 1.00
R8255:Dhx32 UTSW 7 133,339,120 (GRCm39) missense probably benign 0.01
R8389:Dhx32 UTSW 7 133,326,935 (GRCm39) missense possibly damaging 0.95
R8945:Dhx32 UTSW 7 133,323,876 (GRCm39) critical splice donor site probably null
R8949:Dhx32 UTSW 7 133,344,470 (GRCm39) nonsense probably null
R9485:Dhx32 UTSW 7 133,327,110 (GRCm39) missense possibly damaging 0.61
R9720:Dhx32 UTSW 7 133,324,857 (GRCm39) nonsense probably null
R9790:Dhx32 UTSW 7 133,326,267 (GRCm39) missense probably benign 0.35
R9791:Dhx32 UTSW 7 133,326,267 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GTATATTTAGGGACCCAGTGCC -3'
(R):5'- TCCAAGGCAAGAGTGGGTTTAC -3'

Sequencing Primer
(F):5'- ATATTTAGGGACCCAGTGCCATTCTG -3'
(R):5'- TTTACAGACGGGGGTCCTGC -3'
Posted On 2014-11-11