Incidental Mutation 'R2377:Rad21'
ID248328
Institutional Source Beutler Lab
Gene Symbol Rad21
Ensembl Gene ENSMUSG00000022314
Gene NameRAD21 cohesin complex component
SynonymsSCC1
MMRRC Submission 040354-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2377 (G1)
Quality Score217
Status Not validated
Chromosome15
Chromosomal Location51962240-51991747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51968438 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 416 (F416L)
Ref Sequence ENSEMBL: ENSMUSP00000022927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022927]
Predicted Effect probably damaging
Transcript: ENSMUST00000022927
AA Change: F416L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022927
Gene: ENSMUSG00000022314
AA Change: F416L

DomainStartEndE-ValueType
Pfam:Rad21_Rec8_N 1 107 6.6e-43 PFAM
low complexity region 267 283 N/A INTRINSIC
low complexity region 430 440 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
low complexity region 521 547 N/A INTRINSIC
Pfam:Rad21_Rec8 578 632 2.4e-25 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad21, a gene involved in the repair of DNA double-strand breaks, as well as in chromatid cohesion during mitosis. This protein is a nuclear phospho-protein, which becomes hyperphosphorylated in cell cycle M phase. The highly regulated association of this protein with mitotic chromatin specifically at the centromere region suggests its role in sister chromatid cohesion in mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality, reduced male fertility, and produce oocytes that fail to maintain sister chromatids in the first mitosis following fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,467,923 D1304G probably damaging Het
Adamts10 C A 17: 33,528,892 H101N probably damaging Het
Apaf1 T A 10: 91,079,893 K44N possibly damaging Het
Aqr A T 2: 114,140,940 N471K possibly damaging Het
Blvrb T A 7: 27,459,599 I94N probably damaging Het
Ccdc38 C T 10: 93,574,035 P239S probably damaging Het
Chst4 T A 8: 110,030,172 Y270F possibly damaging Het
Col5a1 T C 2: 27,928,177 F138S unknown Het
Dhx32 G T 7: 133,724,478 H407N probably damaging Het
Dock3 G A 9: 106,895,891 P388S probably damaging Het
Fbxo10 A C 4: 45,044,719 Y639D probably benign Het
Fsip2 A G 2: 82,976,249 T971A probably benign Het
Gli2 C T 1: 118,837,125 A1099T possibly damaging Het
Hr C T 14: 70,557,878 L317F probably damaging Het
Ice1 G A 13: 70,602,780 A1729V probably damaging Het
Mcc C G 18: 44,519,549 K269N probably damaging Het
Miga2 T A 2: 30,383,990 C83* probably null Het
Msl1 A G 11: 98,803,963 R273G probably damaging Het
Msl3l2 T C 10: 56,115,563 I128T probably damaging Het
Ntrk1 T A 3: 87,791,407 D109V possibly damaging Het
Olfr126 A G 17: 37,850,607 N5S probably damaging Het
Olfr1307 A T 2: 111,944,643 L271Q probably damaging Het
Olfr142 A G 2: 90,252,911 F26L probably damaging Het
Olfr1447 T A 19: 12,900,853 Y309F possibly damaging Het
Pcmtd2 A G 2: 181,855,279 probably benign Het
Polr1a T C 6: 71,972,826 probably null Het
Ptk2b T A 14: 66,172,548 I452F possibly damaging Het
Scn5a A T 9: 119,539,727 I244N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Tnpo3 A C 6: 29,579,619 N258K probably benign Het
Uba6 T C 5: 86,124,370 D789G possibly damaging Het
Vmn1r226 T G 17: 20,687,730 L75V probably benign Het
Zfp729b A C 13: 67,591,701 V815G possibly damaging Het
Other mutations in Rad21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Rad21 APN 15 51976125 missense possibly damaging 0.76
IGL01328:Rad21 APN 15 51973124 missense probably damaging 1.00
PIT4449001:Rad21 UTSW 15 51973243 missense probably benign 0.25
R0119:Rad21 UTSW 15 51965030 missense probably benign 0.01
R0299:Rad21 UTSW 15 51965030 missense probably benign 0.01
R0385:Rad21 UTSW 15 51973863 missense possibly damaging 0.70
R0440:Rad21 UTSW 15 51968358 missense probably benign 0.24
R1216:Rad21 UTSW 15 51970136 missense possibly damaging 0.70
R1631:Rad21 UTSW 15 51970040 missense probably damaging 1.00
R1763:Rad21 UTSW 15 51978170 missense probably damaging 1.00
R1769:Rad21 UTSW 15 51972307 missense probably benign
R2761:Rad21 UTSW 15 51982643 missense probably damaging 1.00
R3116:Rad21 UTSW 15 51965001 missense probably null 1.00
R3853:Rad21 UTSW 15 51972316 missense probably benign
R3875:Rad21 UTSW 15 51969965 missense probably damaging 0.99
R4618:Rad21 UTSW 15 51970024 missense probably damaging 1.00
R4856:Rad21 UTSW 15 51968500 missense probably damaging 1.00
R4886:Rad21 UTSW 15 51968500 missense probably damaging 1.00
R5022:Rad21 UTSW 15 51966706 missense probably benign 0.02
R5057:Rad21 UTSW 15 51966706 missense probably benign 0.02
R7288:Rad21 UTSW 15 51982580 missense possibly damaging 0.94
Z1088:Rad21 UTSW 15 51982626 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GATCCATGCACTTCCATGCC -3'
(R):5'- TTAGTGCTTAGGAACTGAACTGC -3'

Sequencing Primer
(F):5'- TGCACTTCCATGCCTCCAAAC -3'
(R):5'- TGAACTGCAGCGTTCCTCG -3'
Posted On2014-11-11