Incidental Mutation 'R2378:Tpp2'
ID248336
Institutional Source Beutler Lab
Gene Symbol Tpp2
Ensembl Gene ENSMUSG00000041763
Gene Nametripeptidyl peptidase II
SynonymsTppII
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock #R2378 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location43933647-44003000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43999765 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 223 (E223V)
Ref Sequence ENSEMBL: ENSMUSP00000140313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087933] [ENSMUST00000188313] [ENSMUST00000190207]
Predicted Effect probably benign
Transcript: ENSMUST00000087933
AA Change: E1170V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000085244
Gene: ENSMUSG00000041763
AA Change: E1170V

DomainStartEndE-ValueType
Pfam:Peptidase_S8 35 500 1.4e-96 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 777 964 2.4e-80 PFAM
low complexity region 1017 1033 N/A INTRINSIC
PDB:3LXU|X 1034 1262 1e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187115
Predicted Effect probably benign
Transcript: ENSMUST00000188313
AA Change: E1157V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000139918
Gene: ENSMUSG00000041763
AA Change: E1157V

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 5.1e-83 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 773 966 2.7e-93 PFAM
low complexity region 1004 1020 N/A INTRINSIC
PDB:3LXU|X 1021 1249 1e-20 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000190207
AA Change: E223V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140313
Gene: ENSMUSG00000041763
AA Change: E223V

DomainStartEndE-ValueType
low complexity region 70 86 N/A INTRINSIC
PDB:3LXU|X 87 281 3e-19 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations of this gene result in decreased lifespan and symptoms of immunohematopoietic senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AK157302 T C 13: 21,495,562 I86T possibly damaging Het
Akr1cl A T 1: 65,021,988 M124K probably benign Het
Asap2 T C 12: 21,254,318 L745P possibly damaging Het
B3gnt9 G A 8: 105,254,484 R91C probably damaging Het
Capg C T 6: 72,555,491 P13L probably benign Het
Eif3c C T 7: 126,552,325 R609H probably damaging Het
Ephb3 A G 16: 21,218,243 H152R probably benign Het
Gbp9 T C 5: 105,080,176 D580G probably benign Het
Gm884 A G 11: 103,619,711 probably benign Het
Iars2 A G 1: 185,327,721 Y97H probably damaging Het
Ip6k2 A G 9: 108,796,301 probably null Het
Itih2 T A 2: 10,094,887 D907V probably damaging Het
Msh4 A G 3: 153,863,477 C732R probably damaging Het
Mtss1l T C 8: 110,738,349 F474L probably damaging Het
Nbeal2 T C 9: 110,630,808 E1175G probably damaging Het
Pgm3 A T 9: 86,562,667 C272S probably damaging Het
R3hcc1l T A 19: 42,563,473 I303N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spsb3 A G 17: 24,886,950 probably benign Het
Tgfbr2 G A 9: 116,129,950 T132I probably benign Het
Ttn T A 2: 76,889,450 probably benign Het
Vmn2r102 T G 17: 19,694,668 L832V probably damaging Het
Other mutations in Tpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Tpp2 APN 1 43983291 missense possibly damaging 0.90
IGL01021:Tpp2 APN 1 43934187 nonsense probably null
IGL01096:Tpp2 APN 1 43960888 missense probably damaging 1.00
IGL01344:Tpp2 APN 1 43983262 missense probably benign 0.04
IGL01642:Tpp2 APN 1 43954653 missense probably damaging 1.00
IGL02719:Tpp2 APN 1 43940231 missense probably benign 0.09
IGL02890:Tpp2 APN 1 43999690 missense probably damaging 1.00
IGL03102:Tpp2 APN 1 43956489 missense probably damaging 1.00
IGL03175:Tpp2 APN 1 43973511 missense probably benign 0.35
beaver UTSW 1 43971715 missense probably benign 0.08
cleaver UTSW 1 43978508 nonsense probably null
June UTSW 1 43954710 missense probably damaging 1.00
state UTSW 1 43978438 missense possibly damaging 0.48
wally UTSW 1 43992396 critical splice donor site probably null
Ward UTSW 1 43954736 missense possibly damaging 0.82
R0001:Tpp2 UTSW 1 43971726 missense probably benign 0.00
R0003:Tpp2 UTSW 1 43960139 missense possibly damaging 0.94
R0066:Tpp2 UTSW 1 43981748 missense possibly damaging 0.56
R0110:Tpp2 UTSW 1 43999693 missense probably damaging 1.00
R0110:Tpp2 UTSW 1 43978504 missense probably benign 0.00
R0167:Tpp2 UTSW 1 43970488 missense probably benign 0.01
R0441:Tpp2 UTSW 1 43990562 missense possibly damaging 0.85
R0520:Tpp2 UTSW 1 43990530 missense probably damaging 1.00
R0639:Tpp2 UTSW 1 43975447 missense probably benign 0.00
R1118:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1119:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1593:Tpp2 UTSW 1 43975433 missense probably benign 0.01
R1702:Tpp2 UTSW 1 43990548 missense probably damaging 0.99
R1756:Tpp2 UTSW 1 43978725 splice site probably null
R2066:Tpp2 UTSW 1 43978438 missense possibly damaging 0.48
R2171:Tpp2 UTSW 1 43957446 missense probably benign 0.00
R2394:Tpp2 UTSW 1 43983186 missense possibly damaging 0.83
R2507:Tpp2 UTSW 1 44001449 missense probably benign 0.31
R2879:Tpp2 UTSW 1 43971623 missense probably damaging 1.00
R3436:Tpp2 UTSW 1 43940144 missense probably damaging 0.99
R4106:Tpp2 UTSW 1 44001457 missense possibly damaging 0.71
R4658:Tpp2 UTSW 1 43954710 missense probably damaging 1.00
R4760:Tpp2 UTSW 1 43971715 missense probably benign 0.08
R4963:Tpp2 UTSW 1 43992268 missense probably damaging 1.00
R5049:Tpp2 UTSW 1 44001473 missense possibly damaging 0.46
R5073:Tpp2 UTSW 1 43954736 missense possibly damaging 0.82
R6010:Tpp2 UTSW 1 43951213 critical splice donor site probably null
R6118:Tpp2 UTSW 1 43940146 missense probably damaging 1.00
R6155:Tpp2 UTSW 1 43956489 missense probably damaging 1.00
R6169:Tpp2 UTSW 1 43983579 missense probably damaging 0.99
R6236:Tpp2 UTSW 1 43977317 missense probably benign 0.01
R6695:Tpp2 UTSW 1 43983276 missense probably benign
R6845:Tpp2 UTSW 1 43978508 nonsense probably null
R7054:Tpp2 UTSW 1 43983158 missense probably damaging 1.00
R7094:Tpp2 UTSW 1 43968988 missense probably damaging 1.00
R7223:Tpp2 UTSW 1 43968888 missense probably damaging 1.00
R7316:Tpp2 UTSW 1 43970431 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCTTTAACCAAGTACAATTGCC -3'
(R):5'- CTGCATCTTCTTGAGAGTGGAGAC -3'

Sequencing Primer
(F):5'- ACCAAGTACAATTGCCTTAACTG -3'
(R):5'- GGAGACTCATCTTCATCCTCTTTGG -3'
Posted On2014-11-11