Incidental Mutation 'R2378:Akr1cl'
ID248337
Institutional Source Beutler Lab
Gene Symbol Akr1cl
Ensembl Gene ENSMUSG00000025955
Gene Namealdo-keto reductase family 1, member C-like
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2378 (G1)
Quality Score184
Status Not validated
Chromosome1
Chromosomal Location65012689-65032759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65021988 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 124 (M124K)
Ref Sequence ENSEMBL: ENSMUSP00000123943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069142] [ENSMUST00000159566] [ENSMUST00000162800]
Predicted Effect probably benign
Transcript: ENSMUST00000069142
AA Change: N125K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063309
Gene: ENSMUSG00000025955
AA Change: N125K

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 17 300 3e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159566
AA Change: M124K

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123943
Gene: ENSMUSG00000025955
AA Change: M124K

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 17 141 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162800
AA Change: N94K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124333
Gene: ENSMUSG00000025955
AA Change: N94K

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 2 269 2.1e-57 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AK157302 T C 13: 21,495,562 I86T possibly damaging Het
Asap2 T C 12: 21,254,318 L745P possibly damaging Het
B3gnt9 G A 8: 105,254,484 R91C probably damaging Het
Capg C T 6: 72,555,491 P13L probably benign Het
Eif3c C T 7: 126,552,325 R609H probably damaging Het
Ephb3 A G 16: 21,218,243 H152R probably benign Het
Gbp9 T C 5: 105,080,176 D580G probably benign Het
Gm884 A G 11: 103,619,711 probably benign Het
Iars2 A G 1: 185,327,721 Y97H probably damaging Het
Ip6k2 A G 9: 108,796,301 probably null Het
Itih2 T A 2: 10,094,887 D907V probably damaging Het
Msh4 A G 3: 153,863,477 C732R probably damaging Het
Mtss1l T C 8: 110,738,349 F474L probably damaging Het
Nbeal2 T C 9: 110,630,808 E1175G probably damaging Het
Pgm3 A T 9: 86,562,667 C272S probably damaging Het
R3hcc1l T A 19: 42,563,473 I303N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spsb3 A G 17: 24,886,950 probably benign Het
Tgfbr2 G A 9: 116,129,950 T132I probably benign Het
Tpp2 A T 1: 43,999,765 E223V probably damaging Het
Ttn T A 2: 76,889,450 probably benign Het
Vmn2r102 T G 17: 19,694,668 L832V probably damaging Het
Other mutations in Akr1cl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03299:Akr1cl APN 1 65024715 missense probably damaging 1.00
R1642:Akr1cl UTSW 1 65021429 missense probably benign 0.00
R1807:Akr1cl UTSW 1 65021947 missense possibly damaging 0.90
R2022:Akr1cl UTSW 1 65014698 missense probably benign
R4617:Akr1cl UTSW 1 65021391 missense probably damaging 1.00
R6831:Akr1cl UTSW 1 65014672 splice site probably null
R6848:Akr1cl UTSW 1 65024769 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTAGGAAAGATCTGAGTTTCTTG -3'
(R):5'- AGACAGATGTTTCTCCAGGGG -3'

Sequencing Primer
(F):5'- GATCTAAAGATGCATGTCTGACTCTC -3'
(R):5'- CTGGTATTGAACAGTAATGCAGGTC -3'
Posted On2014-11-11