Incidental Mutation 'R2378:R3hcc1l'
ID248364
Institutional Source Beutler Lab
Gene Symbol R3hcc1l
Ensembl Gene ENSMUSG00000025184
Gene NameR3H domain and coiled-coil containing 1 like
SynonymsD19Ertd386e, 1700036B12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2378 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location42518759-42592343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42563473 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 303 (I303N)
Ref Sequence ENSEMBL: ENSMUSP00000026188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026188] [ENSMUST00000160107] [ENSMUST00000160893]
Predicted Effect probably damaging
Transcript: ENSMUST00000026188
AA Change: I303N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026188
Gene: ENSMUSG00000025184
AA Change: I303N

DomainStartEndE-ValueType
low complexity region 163 178 N/A INTRINSIC
low complexity region 694 706 N/A INTRINSIC
coiled coil region 734 766 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160107
SMART Domains Protein: ENSMUSP00000124036
Gene: ENSMUSG00000025184

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
coiled coil region 154 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162829
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AK157302 T C 13: 21,495,562 I86T possibly damaging Het
Akr1cl A T 1: 65,021,988 M124K probably benign Het
Asap2 T C 12: 21,254,318 L745P possibly damaging Het
B3gnt9 G A 8: 105,254,484 R91C probably damaging Het
Capg C T 6: 72,555,491 P13L probably benign Het
Eif3c C T 7: 126,552,325 R609H probably damaging Het
Ephb3 A G 16: 21,218,243 H152R probably benign Het
Gbp9 T C 5: 105,080,176 D580G probably benign Het
Gm884 A G 11: 103,619,711 probably benign Het
Iars2 A G 1: 185,327,721 Y97H probably damaging Het
Ip6k2 A G 9: 108,796,301 probably null Het
Itih2 T A 2: 10,094,887 D907V probably damaging Het
Msh4 A G 3: 153,863,477 C732R probably damaging Het
Mtss1l T C 8: 110,738,349 F474L probably damaging Het
Nbeal2 T C 9: 110,630,808 E1175G probably damaging Het
Pgm3 A T 9: 86,562,667 C272S probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spsb3 A G 17: 24,886,950 probably benign Het
Tgfbr2 G A 9: 116,129,950 T132I probably benign Het
Tpp2 A T 1: 43,999,765 E223V probably damaging Het
Ttn T A 2: 76,889,450 probably benign Het
Vmn2r102 T G 17: 19,694,668 L832V probably damaging Het
Other mutations in R3hcc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:R3hcc1l APN 19 42563952 missense probably benign 0.04
IGL01731:R3hcc1l APN 19 42562801 missense probably benign 0.01
IGL01921:R3hcc1l APN 19 42563781 missense possibly damaging 0.87
IGL01933:R3hcc1l APN 19 42562950 missense probably damaging 0.99
IGL02047:R3hcc1l APN 19 42563819 missense probably benign 0.20
IGL02658:R3hcc1l APN 19 42562702 missense probably damaging 0.99
IGL02952:R3hcc1l APN 19 42563994 missense probably damaging 0.97
R0233:R3hcc1l UTSW 19 42582921 critical splice donor site probably null
R0233:R3hcc1l UTSW 19 42582921 critical splice donor site probably null
R0254:R3hcc1l UTSW 19 42563148 missense probably damaging 1.00
R0285:R3hcc1l UTSW 19 42576129 missense probably damaging 1.00
R0483:R3hcc1l UTSW 19 42562556 utr 5 prime probably benign
R0727:R3hcc1l UTSW 19 42576075 missense probably damaging 1.00
R1052:R3hcc1l UTSW 19 42563654 missense probably damaging 0.99
R1061:R3hcc1l UTSW 19 42583426 nonsense probably null
R1570:R3hcc1l UTSW 19 42581954 missense probably damaging 1.00
R1641:R3hcc1l UTSW 19 42563607 missense possibly damaging 0.87
R2696:R3hcc1l UTSW 19 42563988 missense possibly damaging 0.94
R3051:R3hcc1l UTSW 19 42562625 nonsense probably null
R3053:R3hcc1l UTSW 19 42562625 nonsense probably null
R4471:R3hcc1l UTSW 19 42582820 splice site probably benign
R4643:R3hcc1l UTSW 19 42562800 missense probably benign 0.09
R4772:R3hcc1l UTSW 19 42583557 splice site probably benign
R5524:R3hcc1l UTSW 19 42563868 nonsense probably null
R5976:R3hcc1l UTSW 19 42563350 missense probably benign 0.06
R6965:R3hcc1l UTSW 19 42562845 missense probably damaging 1.00
R7086:R3hcc1l UTSW 19 42581970 missense probably damaging 0.99
R7158:R3hcc1l UTSW 19 42583429 missense probably damaging 1.00
R7317:R3hcc1l UTSW 19 42583540 nonsense probably null
X0064:R3hcc1l UTSW 19 42583545 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAACTGCACCATCCAGTCTG -3'
(R):5'- AAGCCTTGCTGGTACTGTCAC -3'

Sequencing Primer
(F):5'- TGGAAACACCAGATGGGATGTC -3'
(R):5'- CATCTGTGTCTATTTCATGCACGAGG -3'
Posted On2014-11-11