Incidental Mutation 'R2380:Cog8'
ID248430
Institutional Source Beutler Lab
Gene Symbol Cog8
Ensembl Gene ENSMUSG00000031916
Gene Namecomponent of oligomeric golgi complex 8
SynonymsC87832
MMRRC Submission 040356-MU
Accession Numbers

Genbank: NM_139229; MGI: 2142885

Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R2380 (G1)
Quality Score140
Status Validated
Chromosome8
Chromosomal Location107046289-107056689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107056361 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 99 (G99W)
Ref Sequence ENSEMBL: ENSMUSP00000093173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034391] [ENSMUST00000034392] [ENSMUST00000095517] [ENSMUST00000170962]
Predicted Effect probably damaging
Transcript: ENSMUST00000034391
AA Change: G99W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034391
Gene: ENSMUSG00000031916
AA Change: G99W

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:Dor1 56 394 7.6e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034392
SMART Domains Protein: ENSMUSP00000034392
Gene: ENSMUSG00000031917

DomainStartEndE-ValueType
PUA 95 170 4.36e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095517
AA Change: G99W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093173
Gene: ENSMUSG00000031916
AA Change: G99W

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:Dor1 56 394 7.6e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122903
Predicted Effect unknown
Transcript: ENSMUST00000134772
AA Change: G46W
Predicted Effect probably benign
Transcript: ENSMUST00000170962
SMART Domains Protein: ENSMUSP00000126153
Gene: ENSMUSG00000031917

DomainStartEndE-ValueType
PDB:1T5Y|A 1 133 7e-87 PDB
Blast:PUA 95 123 5e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212281
Meta Mutation Damage Score 0.0276 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the conserved oligomeric Golgi (COG) complex, a multiprotein complex that plays a structural role in the Golgi apparatus, and is involved in intracellular membrane trafficking and glycoprotein modification. Mutations in this gene cause congenital disorder of glycosylation, type IIh, a disease that is characterized by under-glycosylated serum proteins, and whose symptoms include severe psychomotor retardation, failure to thrive, seizures, and dairy and wheat product intolerance. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Targeted, other(2) Gene trapped(20)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T C 15: 82,064,835 S978P possibly damaging Het
Ago3 G A 4: 126,368,522 R412C probably damaging Het
Ampd3 C T 7: 110,800,710 T344M probably damaging Het
Arl10 G T 13: 54,575,149 V19L probably benign Het
Aspm C T 1: 139,479,348 A1991V probably damaging Het
Axdnd1 A T 1: 156,365,651 D655E probably benign Het
Bdp1 T C 13: 100,060,370 H1169R probably benign Het
Cacna1s T C 1: 136,095,848 F942L probably damaging Het
Camk2g A G 14: 20,739,387 I205T probably damaging Het
Cdh5 C A 8: 104,125,672 H140N possibly damaging Het
Csmd1 A G 8: 16,190,087 C1104R probably damaging Het
Dhrs7c G A 11: 67,815,864 V283M probably benign Het
Emilin2 T A 17: 71,310,224 Q64L probably benign Het
Enpp3 T C 10: 24,776,872 E729G probably benign Het
Fam169a T A 13: 97,118,535 probably benign Het
Gm7714 T G 5: 88,282,554 M103R probably benign Het
Gm8979 T C 7: 106,082,167 E627G possibly damaging Het
Hmcn1 T A 1: 150,565,384 M5374L probably benign Het
Hsd17b1 A T 11: 101,078,463 I8F probably damaging Het
Itgae A G 11: 73,145,569 E1111G probably benign Het
Kcmf1 A G 6: 72,858,772 probably null Het
Kdm1b T A 13: 47,073,755 F574L probably damaging Het
Lgr4 T C 2: 110,012,393 Y908H probably damaging Het
Lig1 T C 7: 13,303,796 probably benign Het
Ltbp3 C A 19: 5,751,523 C698* probably null Het
Ncor2 A G 5: 125,036,080 V1216A possibly damaging Het
Olfr1156 T C 2: 87,949,397 T279A probably damaging Het
Olfr1463 T C 19: 13,234,721 V157A probably benign Het
Olfr594 A T 7: 103,220,608 T297S possibly damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp5c A G 7: 17,006,115 Y434H probably damaging Het
Pwwp2b A G 7: 139,255,450 E269G probably damaging Het
Rgs3 A T 4: 62,625,887 T299S probably benign Het
Skint5 G A 4: 113,546,536 T1163I unknown Het
Slc35f4 A G 14: 49,306,203 probably null Het
Trmt5 A G 12: 73,285,114 I4T probably benign Het
Ttc7b A G 12: 100,355,001 probably null Het
Utp6 A G 11: 79,936,005 S582P possibly damaging Het
Zbtb41 T C 1: 139,423,814 S222P probably damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Cog8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Cog8 APN 8 107054065 missense probably benign 0.23
IGL01959:Cog8 APN 8 107056378 missense probably damaging 1.00
IGL02563:Cog8 APN 8 107056423 missense possibly damaging 0.70
IGL02961:Cog8 APN 8 107056253 unclassified probably benign
R0076:Cog8 UTSW 8 107054133 missense possibly damaging 0.96
R0255:Cog8 UTSW 8 107049145 unclassified probably benign
R0433:Cog8 UTSW 8 107056478 missense possibly damaging 0.52
R0990:Cog8 UTSW 8 107052487 unclassified probably null
R1457:Cog8 UTSW 8 107052896 missense probably damaging 1.00
R1567:Cog8 UTSW 8 107054108 nonsense probably null
R2239:Cog8 UTSW 8 107056361 missense probably damaging 1.00
R2910:Cog8 UTSW 8 107054221 missense probably benign 0.25
R3978:Cog8 UTSW 8 107053037 missense probably damaging 1.00
R4560:Cog8 UTSW 8 107052211 critical splice donor site probably null
R4863:Cog8 UTSW 8 107050174 missense probably damaging 1.00
R4879:Cog8 UTSW 8 107056352 missense probably damaging 0.99
R5026:Cog8 UTSW 8 107049125 missense probably benign
R5721:Cog8 UTSW 8 107050148 missense probably benign 0.00
R6489:Cog8 UTSW 8 107050301 missense probably benign 0.00
T0722:Cog8 UTSW 8 107048993 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTTGGGTCATGACGATAGC -3'
(R):5'- TACCGTGCTTGAGAGATGGC -3'

Sequencing Primer
(F):5'- TAGCGTCCTGGCAGATACAATGAC -3'
(R):5'- TGGAAGATGAGGGCCTCCTG -3'
Posted On2014-11-11