Incidental Mutation 'R2381:Pmepa1'
ID248452
Institutional Source Beutler Lab
Gene Symbol Pmepa1
Ensembl Gene ENSMUSG00000038400
Gene Nameprostate transmembrane protein, androgen induced 1
SynonymsN4wbp4, Tmepai, 2210418I02Rik, PMEPA1, STAG1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2381 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location173224458-173276533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 173228133 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 210 (R210W)
Ref Sequence ENSEMBL: ENSMUSP00000115534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036248] [ENSMUST00000139306]
Predicted Effect probably damaging
Transcript: ENSMUST00000036248
AA Change: R172W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039950
Gene: ENSMUSG00000038400
AA Change: R172W

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124124
Predicted Effect probably damaging
Transcript: ENSMUST00000139306
AA Change: R210W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115534
Gene: ENSMUSG00000038400
AA Change: R210W

DomainStartEndE-ValueType
transmembrane domain 75 97 N/A INTRINSIC
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that contains a Smad interacting motif (SIM). Expression of this gene is induced by androgens and transforming growth factor beta, and the encoded protein suppresses the androgen receptor and transforming growth factor beta signaling pathways though interactions with Smad proteins. Overexpression of this gene may play a role in multiple types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik T C X: 89,930,510 I694V probably benign Het
9330182L06Rik C T 5: 9,380,342 P84L probably damaging Het
Cd248 G T 19: 5,069,193 M356I possibly damaging Het
Cul4a T C 8: 13,136,887 V541A probably benign Het
Dnajb1 T A 8: 83,610,342 F147Y possibly damaging Het
Dnhd1 A G 7: 105,693,664 K1405R probably benign Het
Dpys C A 15: 39,842,054 R221L probably damaging Het
Gm12253 C T 11: 58,435,458 R100C probably damaging Het
Inppl1 A T 7: 101,829,232 S592R probably damaging Het
Lct G A 1: 128,304,121 Q664* probably null Het
Olfr846 T A 9: 19,360,457 E299D probably benign Het
Pnpla7 A C 2: 24,980,758 K80T probably damaging Het
Slc4a1 T C 11: 102,359,302 D105G probably benign Het
Tpo A G 12: 30,131,827 I23T possibly damaging Het
Unc5c A G 3: 141,678,155 E98G probably damaging Het
Usp13 G A 3: 32,881,509 probably null Het
Vmn1r175 G A 7: 23,808,668 T178I probably benign Het
Zgrf1 A T 3: 127,556,214 M15L probably benign Het
Other mutations in Pmepa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1401:Pmepa1 UTSW 2 173228575 critical splice donor site probably null
R1439:Pmepa1 UTSW 2 173228081 missense probably benign 0.13
R1772:Pmepa1 UTSW 2 173234360 missense probably damaging 1.00
R2228:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2229:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2380:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2382:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2385:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2386:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3783:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3784:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3785:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3787:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R4600:Pmepa1 UTSW 2 173228327 missense possibly damaging 0.81
R5368:Pmepa1 UTSW 2 173228322 missense probably damaging 1.00
R5982:Pmepa1 UTSW 2 173234312 missense possibly damaging 0.82
R7371:Pmepa1 UTSW 2 173234419 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CAATGACCTCGCTGTAGGTG -3'
(R):5'- GAATCCAACCTCAGTCTGCC -3'

Sequencing Primer
(F):5'- GATGCCCGAGTTACTGC -3'
(R):5'- TCCAGCCACAGGTCTATGC -3'
Posted On2014-11-11