Incidental Mutation 'R2397:Fscn2'
ID248562
Institutional Source Beutler Lab
Gene Symbol Fscn2
Ensembl Gene ENSMUSG00000025380
Gene Namefascin actin-bundling protein 2
SynonymsC630046B20Rik, ahl8
MMRRC Submission 040364-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R2397 (G1)
Quality Score135
Status Validated
Chromosome11
Chromosomal Location120361534-120368168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120362169 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 154 (L154P)
Ref Sequence ENSEMBL: ENSMUSP00000026445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026445]
Predicted Effect probably damaging
Transcript: ENSMUST00000026445
AA Change: L154P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026445
Gene: ENSMUSG00000025380
AA Change: L154P

DomainStartEndE-ValueType
Pfam:Fascin 20 133 4.9e-34 PFAM
Pfam:Fascin 141 254 1.2e-26 PFAM
Pfam:Fascin 266 376 8.9e-35 PFAM
Pfam:Fascin 389 492 4.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152556
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fascin protein family. Fascins crosslink actin into filamentous bundles within dynamic cell extensions. This family member is proposed to play a role in photoreceptor disk morphogenesis. A mutation in this gene results in one form of autosomal dominant retinitis pigmentosa and macular degeneration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display retinal generation with structural abnormalities of the outer segment and depressed rod and cone ERGs that worsen with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 T A 8: 55,872,898 M174L probably benign Het
Adamtsl1 C T 4: 86,199,357 R186W probably damaging Het
Agtpbp1 C T 13: 59,474,569 V948I probably benign Het
Atp13a2 A G 4: 141,003,155 T787A probably benign Het
Capn11 T A 17: 45,653,221 N139I probably damaging Het
Cars T C 7: 143,592,507 D60G possibly damaging Het
Cers1 A T 8: 70,321,536 I148F probably benign Het
Col14a1 T C 15: 55,338,439 I41T unknown Het
Cyp2d26 C T 15: 82,794,035 G47R probably damaging Het
Dhx36 A T 3: 62,498,097 M205K probably benign Het
Dyrk2 T A 10: 118,861,368 probably benign Het
Echs1 T C 7: 140,112,477 H119R possibly damaging Het
Ehf T A 2: 103,276,819 D120V probably damaging Het
Esrra A G 19: 6,920,176 L71P probably damaging Het
Fam228a A T 12: 4,718,718 S200R probably benign Het
Fibcd1 A T 2: 31,834,423 M191K probably benign Het
Foxn4 A G 5: 114,255,495 L521P probably damaging Het
Gm7964 T G 7: 83,757,113 noncoding transcript Het
Golga3 T C 5: 110,205,877 probably benign Het
Gria4 A G 9: 4,537,717 L197P probably damaging Het
Heg1 T A 16: 33,742,479 M913K probably damaging Het
Ifi205 T C 1: 174,017,575 T214A possibly damaging Het
Ift140 T G 17: 25,020,736 D122E probably damaging Het
Jakmip1 T A 5: 37,100,743 D244E probably damaging Het
Krt84 A G 15: 101,530,254 V266A probably benign Het
Mc2r T A 18: 68,408,153 D23V probably benign Het
Ncr1 T A 7: 4,338,261 F47I probably benign Het
Nr1h3 G A 2: 91,191,857 T142I possibly damaging Het
Obox2 C T 7: 15,397,046 P68S probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Parn A G 16: 13,566,654 V515A probably benign Het
Ptdss2 T A 7: 141,147,092 F105I probably benign Het
Ruvbl1 A C 6: 88,465,552 T9P possibly damaging Het
Slc15a3 A G 19: 10,843,043 E8G probably benign Het
Slf1 G T 13: 77,103,583 Y303* probably null Het
Socs5 T C 17: 87,134,949 F439S probably damaging Het
Tcp10c C A 17: 13,370,211 A357E probably damaging Het
Tmem200c T C 17: 68,840,947 V175A probably damaging Het
Vmn2r124 T A 17: 18,049,597 H38Q possibly damaging Het
Vmn2r54 T G 7: 12,615,651 Q668P probably damaging Het
Xrcc2 T C 5: 25,705,710 S3G probably null Het
Other mutations in Fscn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Fscn2 APN 11 120367305 missense probably damaging 0.99
IGL01767:Fscn2 APN 11 120367750 missense possibly damaging 0.82
IGL02212:Fscn2 APN 11 120362055 missense probably damaging 1.00
IGL02299:Fscn2 APN 11 120362199 missense probably benign 0.09
IGL02494:Fscn2 APN 11 120362402 missense probably benign 0.02
IGL02716:Fscn2 APN 11 120366724 missense probably benign 0.00
IGL02882:Fscn2 APN 11 120362499 missense probably benign
IGL02986:Fscn2 APN 11 120367350 missense possibly damaging 0.74
ANU74:Fscn2 UTSW 11 120362336 missense probably damaging 1.00
R0277:Fscn2 UTSW 11 120368011 missense probably damaging 1.00
R0323:Fscn2 UTSW 11 120368011 missense probably damaging 1.00
R0513:Fscn2 UTSW 11 120361880 missense probably damaging 1.00
R1451:Fscn2 UTSW 11 120362022 missense probably damaging 0.98
R1620:Fscn2 UTSW 11 120366685 missense probably damaging 1.00
R1736:Fscn2 UTSW 11 120368026 missense probably damaging 1.00
R2212:Fscn2 UTSW 11 120361591 start gained probably benign
R2327:Fscn2 UTSW 11 120366701 missense probably damaging 1.00
R2384:Fscn2 UTSW 11 120366733 missense possibly damaging 0.48
R4624:Fscn2 UTSW 11 120367343 missense probably benign 0.21
R4634:Fscn2 UTSW 11 120367720 missense possibly damaging 0.65
R4784:Fscn2 UTSW 11 120367987 missense possibly damaging 0.82
R5062:Fscn2 UTSW 11 120366749 missense probably damaging 1.00
R5084:Fscn2 UTSW 11 120361860 missense probably damaging 0.96
R5514:Fscn2 UTSW 11 120368032 missense probably damaging 1.00
R5780:Fscn2 UTSW 11 120366668 missense probably benign 0.14
R6073:Fscn2 UTSW 11 120361787 nonsense probably null
R6345:Fscn2 UTSW 11 120362027 missense probably damaging 0.99
R7110:Fscn2 UTSW 11 120366754 missense probably benign 0.19
R7170:Fscn2 UTSW 11 120362509 missense probably damaging 0.98
R7171:Fscn2 UTSW 11 120362509 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGCCTGTGAGATGGATCAG -3'
(R):5'- CCTTGAACTCCAGCGTGTAG -3'

Sequencing Primer
(F):5'- TCTTGCCGCAGCCTGATG -3'
(R):5'- TAGCAGGCATGGGCTTCAG -3'
Posted On2014-11-11