Mutagenetix > Incidental Mutation

Incidental Mutation 'R2397:Ift140'

248574

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

040364-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2397 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25235056-25318461 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 25239710 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 122 (D122E)

Ref Sequence

ENSEMBL: ENSMUSP00000116163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]

AlphaFold

E9PY46

Predicted Effect

probably damaging
Transcript: ENSMUST00000024983
AA Change: D122E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: D122E

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000137386
AA Change: D122E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: D122E

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151776

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 98.4%
10x: 96.8%
20x: 93.4%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam29	T	A	8: 56,325,933 (GRCm39)	M174L	probably benign	Het
Adamtsl1	C	T	4: 86,117,594 (GRCm39)	R186W	probably damaging	Het
Agtpbp1	C	T	13: 59,622,383 (GRCm39)	V948I	probably benign	Het
Atp13a2	A	G	4: 140,730,466 (GRCm39)	T787A	probably benign	Het
Capn11	T	A	17: 45,964,147 (GRCm39)	N139I	probably damaging	Het
Cars1	T	C	7: 143,146,244 (GRCm39)	D60G	possibly damaging	Het
Cers1	A	T	8: 70,774,186 (GRCm39)	I148F	probably benign	Het
Col14a1	T	C	15: 55,201,835 (GRCm39)	I41T	unknown	Het
Cyp2d26	C	T	15: 82,678,236 (GRCm39)	G47R	probably damaging	Het
Dhx36	A	T	3: 62,405,518 (GRCm39)	M205K	probably benign	Het
Dyrk2	T	A	10: 118,697,273 (GRCm39)		probably benign	Het
Echs1	T	C	7: 139,692,390 (GRCm39)	H119R	possibly damaging	Het
Ehf	T	A	2: 103,107,164 (GRCm39)	D120V	probably damaging	Het
Esrra	A	G	19: 6,897,544 (GRCm39)	L71P	probably damaging	Het
Fam228a	A	T	12: 4,768,718 (GRCm39)	S200R	probably benign	Het
Fibcd1	A	T	2: 31,724,435 (GRCm39)	M191K	probably benign	Het
Foxn4	A	G	5: 114,393,556 (GRCm39)	L521P	probably damaging	Het
Fscn2	T	C	11: 120,252,995 (GRCm39)	L154P	probably damaging	Het
Gm7964	T	G	7: 83,406,321 (GRCm39)		noncoding transcript	Het
Golga3	T	C	5: 110,353,743 (GRCm39)		probably benign	Het
Gria4	A	G	9: 4,537,717 (GRCm39)	L197P	probably damaging	Het
Heg1	T	A	16: 33,562,849 (GRCm39)	M913K	probably damaging	Het
Ifi205	T	C	1: 173,845,141 (GRCm39)	T214A	possibly damaging	Het
Jakmip1	T	A	5: 37,258,087 (GRCm39)	D244E	probably damaging	Het
Krt84	A	G	15: 101,438,689 (GRCm39)	V266A	probably benign	Het
Mc2r	T	A	18: 68,541,224 (GRCm39)	D23V	probably benign	Het
Ncr1	T	A	7: 4,341,260 (GRCm39)	F47I	probably benign	Het
Nr1h3	G	A	2: 91,022,202 (GRCm39)	T142I	possibly damaging	Het
Obox2	C	T	7: 15,130,971 (GRCm39)	P68S	probably benign	Het
Pacs2	G	A	12: 113,026,987 (GRCm39)	D605N	probably damaging	Het
Parn	A	G	16: 13,384,518 (GRCm39)	V515A	probably benign	Het
Ptdss2	T	A	7: 140,727,005 (GRCm39)	F105I	probably benign	Het
Ruvbl1	A	C	6: 88,442,534 (GRCm39)	T9P	possibly damaging	Het
Slc15a3	A	G	19: 10,820,407 (GRCm39)	E8G	probably benign	Het
Slf1	G	T	13: 77,251,702 (GRCm39)	Y303*	probably null	Het
Socs5	T	C	17: 87,442,377 (GRCm39)	F439S	probably damaging	Het
Tcp10c	C	A	17: 13,590,473 (GRCm39)	A357E	probably damaging	Het
Tmem200c	T	C	17: 69,147,942 (GRCm39)	V175A	probably damaging	Het
Vmn2r124	T	A	17: 18,269,859 (GRCm39)	H38Q	possibly damaging	Het
Vmn2r54	T	G	7: 12,349,578 (GRCm39)	Q668P	probably damaging	Het
Xrcc2	T	C	5: 25,910,708 (GRCm39)	S3G	probably null	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25,274,618 (GRCm39)	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25,237,776 (GRCm39)	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25,267,429 (GRCm39)	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25,313,676 (GRCm39)	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25,305,999 (GRCm39)	splice site	probably null
IGL01994:Ift140	APN	17	25,267,417 (GRCm39)	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25,252,104 (GRCm39)	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25,274,572 (GRCm39)	missense	probably benign
IGL02493:Ift140	APN	17	25,306,898 (GRCm39)	nonsense	probably null
IGL02735:Ift140	APN	17	25,253,009 (GRCm39)	splice site	probably benign
IGL02902:Ift140	APN	17	25,309,736 (GRCm39)	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25,311,368 (GRCm39)	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25,305,884 (GRCm39)	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25,311,800 (GRCm39)	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25,306,880 (GRCm39)	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25,306,958 (GRCm39)	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25,305,834 (GRCm39)	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25,309,928 (GRCm39)	nonsense	probably null
R0100:Ift140	UTSW	17	25,309,928 (GRCm39)	nonsense	probably null
R0197:Ift140	UTSW	17	25,309,907 (GRCm39)	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25,264,497 (GRCm39)	nonsense	probably null
R0238:Ift140	UTSW	17	25,264,497 (GRCm39)	nonsense	probably null
R0239:Ift140	UTSW	17	25,264,497 (GRCm39)	nonsense	probably null
R0239:Ift140	UTSW	17	25,264,497 (GRCm39)	nonsense	probably null
R0355:Ift140	UTSW	17	25,267,409 (GRCm39)	nonsense	probably null
R0399:Ift140	UTSW	17	25,269,314 (GRCm39)	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25,270,734 (GRCm39)	splice site	probably null
R0610:Ift140	UTSW	17	25,254,777 (GRCm39)	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25,309,907 (GRCm39)	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25,309,907 (GRCm39)	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25,254,786 (GRCm39)	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25,254,719 (GRCm39)	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25,307,907 (GRCm39)	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25,306,959 (GRCm39)	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25,307,839 (GRCm39)	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25,244,608 (GRCm39)	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25,254,813 (GRCm39)	missense	probably benign	0.05
R2510:Ift140	UTSW	17	25,255,282 (GRCm39)	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25,254,805 (GRCm39)	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25,255,282 (GRCm39)	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25,247,918 (GRCm39)	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25,309,741 (GRCm39)	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25,317,935 (GRCm39)	unclassified	probably benign
R4711:Ift140	UTSW	17	25,313,691 (GRCm39)	splice site	probably null
R4934:Ift140	UTSW	17	25,267,462 (GRCm39)	missense	probably benign
R4949:Ift140	UTSW	17	25,313,639 (GRCm39)	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25,255,968 (GRCm39)	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25,309,674 (GRCm39)	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25,254,786 (GRCm39)	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25,239,601 (GRCm39)	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25,252,059 (GRCm39)	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25,239,550 (GRCm39)	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25,264,038 (GRCm39)	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25,247,787 (GRCm39)	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25,308,514 (GRCm39)	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25,252,893 (GRCm39)	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25,311,345 (GRCm39)	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25,313,735 (GRCm39)	nonsense	probably null
R6000:Ift140	UTSW	17	25,255,934 (GRCm39)	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25,274,563 (GRCm39)	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25,309,979 (GRCm39)	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25,312,100 (GRCm39)	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25,247,946 (GRCm39)	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25,269,408 (GRCm39)	missense	probably benign
R6539:Ift140	UTSW	17	25,313,643 (GRCm39)	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25,251,147 (GRCm39)	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25,252,090 (GRCm39)	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25,317,890 (GRCm39)	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25,239,520 (GRCm39)	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25,274,699 (GRCm39)	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25,239,619 (GRCm39)	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25,256,010 (GRCm39)	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25,252,089 (GRCm39)	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25,311,315 (GRCm39)	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25,270,798 (GRCm39)	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25,255,949 (GRCm39)	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25,311,889 (GRCm39)	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25,313,651 (GRCm39)	missense	probably damaging	0.99
R8747:Ift140	UTSW	17	25,254,809 (GRCm39)	missense	probably benign
R8932:Ift140	UTSW	17	25,305,862 (GRCm39)	missense	probably benign	0.03
R9226:Ift140	UTSW	17	25,317,839 (GRCm39)	missense	probably benign	0.00
R9347:Ift140	UTSW	17	25,313,753 (GRCm39)	missense	probably benign	0.00
R9451:Ift140	UTSW	17	25,252,925 (GRCm39)	missense	probably benign	0.33
R9456:Ift140	UTSW	17	25,254,758 (GRCm39)	missense	probably benign	0.03
R9782:Ift140	UTSW	17	25,264,151 (GRCm39)	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTCCAGGCCACTTCACTGTG -3'
(R):5'- CATTCTATCTCCACGAGTGCAACC -3'

Sequencing Primer
(F):5'- TGTGCTGGCACCCAACAAG -3'
(R):5'- GGTCCTGAGTTCAAATCCCAG -3'

Posted On

2014-11-11