Incidental Mutation 'R2398:Ap3d1'
ID248602
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Nameadaptor-related protein complex 3, delta 1 subunit
SynonymsmBLVR1, Bolvr
MMRRC Submission 040365-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R2398 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80706956-80742264 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 80719172 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 440 (Q440*)
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420]
Predicted Effect probably null
Transcript: ENSMUST00000020420
AA Change: Q440*
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: Q440*

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219253
Predicted Effect probably benign
Transcript: ENSMUST00000219356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220183
Meta Mutation Damage Score 0.616 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,860 D160G possibly damaging Het
Akr1c6 T C 13: 4,449,036 S208P probably benign Het
Ap3b2 A G 7: 81,477,195 F269S probably damaging Het
Cog2 T C 8: 124,529,926 I137T probably benign Het
Cse1l A G 2: 166,928,997 Y369C probably damaging Het
Dnah9 T C 11: 65,915,203 N3357D probably damaging Het
Fam83b T C 9: 76,502,218 T209A probably damaging Het
Gbp2 G A 3: 142,633,362 A392T probably benign Het
Grsf1 G A 5: 88,673,836 T123I probably damaging Het
Gzmc T A 14: 56,232,771 I90F possibly damaging Het
Hook2 T A 8: 84,991,299 N42K probably damaging Het
Hsp90aa1 T C 12: 110,692,321 M629V possibly damaging Het
Ifna14 T C 4: 88,571,626 D58G possibly damaging Het
Krtap4-8 T C 11: 99,780,277 probably benign Het
Mocs1 T C 17: 49,452,834 I381T probably damaging Het
Nbas A G 12: 13,432,945 T1408A probably damaging Het
Olfr1057 T A 2: 86,374,839 D191V probably damaging Het
Olfr818 A G 10: 129,945,207 F285S probably benign Het
Orc1 C T 4: 108,601,969 T445I possibly damaging Het
Pdik1l T C 4: 134,278,399 K411E probably benign Het
Pias3 A G 3: 96,703,813 I443V probably benign Het
Psmd2 T C 16: 20,659,472 S536P possibly damaging Het
Rnf10 C T 5: 115,247,273 R554H probably benign Het
Smarcc2 C T 10: 128,469,682 T325I possibly damaging Het
Smchd1 C A 17: 71,360,141 C1752F probably damaging Het
Smchd1 G A 17: 71,426,436 probably benign Het
Svil A G 18: 5,060,613 probably null Het
Tex52 T C 6: 128,379,577 S78P probably damaging Het
Tmem63c T G 12: 87,056,533 V27G probably damaging Het
Ttc41 A G 10: 86,713,386 N148S possibly damaging Het
Vmn2r67 T C 7: 85,136,713 I695V probably damaging Het
Wipf2 T A 11: 98,898,717 probably null Het
Zc3h18 A G 8: 122,413,866 probably benign Het
Zfp804a T A 2: 82,258,669 N947K possibly damaging Het
Zfyve26 T C 12: 79,282,799 probably null Het
Zic2 G T 14: 122,478,917 E422* probably null Het
Zmym4 A T 4: 126,923,136 D4E probably damaging Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80741979 missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80713559 missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80719159 missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80709258 nonsense probably null
IGL03404:Ap3d1 APN 10 80730037 missense probably damaging 1.00
christian UTSW 10 80730042 missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80723615 splice site probably benign
R0197:Ap3d1 UTSW 10 80730042 missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80727978 missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80723567 missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80719241 missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80719382 nonsense probably null
R0792:Ap3d1 UTSW 10 80708479 missense probably benign
R0942:Ap3d1 UTSW 10 80732955 splice site probably benign
R1015:Ap3d1 UTSW 10 80716489 missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80714258 missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80732840 splice site probably benign
R1540:Ap3d1 UTSW 10 80715941 missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80730010 missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80717737 nonsense probably null
R1669:Ap3d1 UTSW 10 80710836 unclassified probably benign
R1839:Ap3d1 UTSW 10 80727108 missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80709773 missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80732936 missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80721132 missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80713998 missense probably damaging 0.96
R2849:Ap3d1 UTSW 10 80741908 missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80712185 missense probably benign
R4350:Ap3d1 UTSW 10 80719285 missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80719812 nonsense probably null
R4782:Ap3d1 UTSW 10 80721586 splice site probably null
R4785:Ap3d1 UTSW 10 80712778 frame shift probably null
R4834:Ap3d1 UTSW 10 80719726 missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80712778 frame shift probably null
R5051:Ap3d1 UTSW 10 80719199 missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80709450 missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80709817 missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80727167 missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80723549 missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80719130 missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80714037 missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80710464 missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80710494 intron probably null
R6469:Ap3d1 UTSW 10 80712158 missense probably benign
R6603:Ap3d1 UTSW 10 80714047 missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80714322 nonsense probably null
R6887:Ap3d1 UTSW 10 80723698 missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80741933 missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80717859 missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80723803 missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80730882 missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80741900 missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80721592 missense probably damaging 1.00
X0019:Ap3d1 UTSW 10 80719102 missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80721147 missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80719237 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GATCTGTCTGCGTACATGTCCC -3'
(R):5'- TCATGACTCACGTGGACAAG -3'

Sequencing Primer
(F):5'- ACTAGGCCACTTCCAAGGG -3'
(R):5'- CTCACGTGGACAAGGCTGAG -3'
Posted On2014-11-11