Incidental Mutation 'R2399:Olfr862'
ID248633
Institutional Source Beutler Lab
Gene Symbol Olfr862
Ensembl Gene ENSMUSG00000063842
Gene Nameolfactory receptor 862
SynonymsGA_x6K02T2PVTD-13624132-13623212, MOR146-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R2399 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19882417-19888004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 19883924 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 127 (C127Y)
Ref Sequence ENSEMBL: ENSMUSP00000078603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073765] [ENSMUST00000079660]
Predicted Effect probably damaging
Transcript: ENSMUST00000073765
AA Change: C127Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073437
Gene: ENSMUSG00000063842
AA Change: C127Y

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:7tm_4 31 306 3.1e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 282 1.3e-7 PFAM
Pfam:7tm_1 41 290 5.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079660
AA Change: C127Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078603
Gene: ENSMUSG00000063842
AA Change: C127Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 303 8.3e-8 PFAM
Pfam:7tm_1 41 290 4.5e-22 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,972,479 E365G probably damaging Het
Abtb1 G A 6: 88,838,738 T221M possibly damaging Het
Atp2b1 T A 10: 98,999,923 I510N probably benign Het
Atr T A 9: 95,871,599 H751Q probably benign Het
Cacna1d T C 14: 30,052,487 D1650G probably benign Het
Cd93 A G 2: 148,442,151 I425T probably benign Het
Dpep2 A G 8: 105,989,592 S135P probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Heatr4 T C 12: 83,980,333 H50R probably benign Het
Itga6 T C 2: 71,820,014 Y135H probably damaging Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,662,349 probably benign Het
Myh15 T C 16: 49,137,589 I923T probably damaging Het
Olfr1462 T A 19: 13,191,345 I226K probably benign Het
Olfr828 T A 9: 18,816,027 D89V probably benign Het
Styxl1 C T 5: 135,747,781 E318K possibly damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Zc3h7a G A 16: 11,147,401 R623C probably damaging Het
Zfp608 T C 18: 54,897,902 K989E probably damaging Het
Other mutations in Olfr862
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Olfr862 APN 9 19883548 nonsense probably null
IGL01636:Olfr862 APN 9 19884188 missense probably benign 0.14
IGL01765:Olfr862 APN 9 19883951 missense possibly damaging 0.71
IGL01967:Olfr862 APN 9 19883589 missense probably damaging 0.97
IGL03145:Olfr862 APN 9 19883439 missense possibly damaging 0.93
IGL03222:Olfr862 APN 9 19884199 nonsense probably null
R0117:Olfr862 UTSW 9 19884299 missense probably damaging 0.96
R0662:Olfr862 UTSW 9 19883952 missense probably benign 0.32
R4224:Olfr862 UTSW 9 19883600 missense probably benign 0.44
R4572:Olfr862 UTSW 9 19883979 missense probably benign
R5607:Olfr862 UTSW 9 19883976 missense probably benign 0.16
R5741:Olfr862 UTSW 9 19883561 missense possibly damaging 0.92
R5759:Olfr862 UTSW 9 19884188 missense probably benign 0.14
R6237:Olfr862 UTSW 9 19884069 missense probably damaging 1.00
R6434:Olfr862 UTSW 9 19883845 nonsense probably null
R7075:Olfr862 UTSW 9 19884063 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CAGGCAAGTTTTAGAAGCTCTGG -3'
(R):5'- TCCACAGCCCAATGTACTTC -3'

Sequencing Primer
(F):5'- GCAAGTTTTAGAAGCTCTGGAATATC -3'
(R):5'- ACAACCTTTCATTGTCTGACATGGG -3'
Posted On2014-11-11