Incidental Mutation 'R2400:Csn1s2a'
ID248652
Institutional Source Beutler Lab
Gene Symbol Csn1s2a
Ensembl Gene ENSMUSG00000061937
Gene Namecasein alpha s2-like A
SynonymsCsn1s2a, Csng
MMRRC Submission 040366-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R2400 (G1)
Quality Score221
Status Not validated
Chromosome5
Chromosomal Location87774567-87788797 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 87780155 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076379] [ENSMUST00000196585] [ENSMUST00000196749] [ENSMUST00000200322]
Predicted Effect probably null
Transcript: ENSMUST00000076379
SMART Domains Protein: ENSMUSP00000075716
Gene: ENSMUSG00000061937

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
coiled coil region 58 86 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196585
SMART Domains Protein: ENSMUSP00000143515
Gene: ENSMUSG00000061937

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
low complexity region 51 80 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196749
SMART Domains Protein: ENSMUSP00000143715
Gene: ENSMUSG00000061937

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
coiled coil region 57 85 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200210
Predicted Effect probably null
Transcript: ENSMUST00000200322
SMART Domains Protein: ENSMUSP00000142901
Gene: ENSMUSG00000061937

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
low complexity region 51 57 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,493,365 T133A unknown Het
Adgrl2 G T 3: 148,851,934 S519R probably damaging Het
AU041133 A T 10: 82,150,908 K132* probably null Het
Bhlhe22 A G 3: 18,055,451 N222D probably damaging Het
Cep72 C A 13: 74,048,977 A69S probably damaging Het
Dapk1 T A 13: 60,752,216 F872I probably benign Het
Dhx57 T C 17: 80,260,416 D746G probably damaging Het
Dnah17 T A 11: 118,126,384 probably null Het
Fgg A G 3: 83,008,187 D37G possibly damaging Het
Fnip2 G T 3: 79,479,634 S958R probably benign Het
Gfpt1 A G 6: 87,087,348 D640G probably damaging Het
Golgb1 C A 16: 36,918,466 T2389K possibly damaging Het
Hmgcl C A 4: 135,952,368 probably null Het
Mmp11 T A 10: 75,925,510 T419S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Nkiras1 T A 14: 18,280,011 V108E possibly damaging Het
Pcsk1 T C 13: 75,090,126 L22P probably benign Het
Rnf213 T C 11: 119,443,195 Y3077H probably damaging Het
Sec62 A G 3: 30,810,532 N182D unknown Het
Serpinb5 A G 1: 106,881,952 T363A probably damaging Het
Usf3 T A 16: 44,215,747 S197T probably benign Het
Vmn2r11 T A 5: 109,052,062 E508D probably benign Het
Wdr81 A G 11: 75,449,035 F1376L probably benign Het
Zfp260 T C 7: 30,104,701 S9P possibly damaging Het
Other mutations in Csn1s2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Csn1s2a APN 5 87784580 missense possibly damaging 0.83
IGL01829:Csn1s2a APN 5 87786710 missense unknown
R0137:Csn1s2a UTSW 5 87778967 missense possibly damaging 0.46
R1503:Csn1s2a UTSW 5 87775799 missense possibly damaging 0.66
R1799:Csn1s2a UTSW 5 87778193 missense probably damaging 0.97
R1870:Csn1s2a UTSW 5 87778199 missense probably benign 0.27
R2897:Csn1s2a UTSW 5 87781821 missense unknown
R4034:Csn1s2a UTSW 5 87781887 missense probably benign 0.27
R4360:Csn1s2a UTSW 5 87781841 missense possibly damaging 0.46
R4377:Csn1s2a UTSW 5 87775821 missense probably benign
R4834:Csn1s2a UTSW 5 87781778 missense probably benign 0.27
R4965:Csn1s2a UTSW 5 87781838 missense possibly damaging 0.83
R6807:Csn1s2a UTSW 5 87781872 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCCTGACTTTCTACTAAAATCATCG -3'
(R):5'- GCATTTGGACTAATTACATGACTGAGG -3'

Sequencing Primer
(F):5'- TCTTCCGAGGAAGTCAGT -3'
(R):5'- CATGACTGAGGTAATACACAGATATC -3'
Posted On2014-11-11