Incidental Mutation 'R2401:Itgb4'
ID248704
Institutional Source Beutler Lab
Gene Symbol Itgb4
Ensembl Gene ENSMUSG00000020758
Gene Nameintegrin beta 4
SynonymsCD104
MMRRC Submission 040367-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2401 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115974709-116008412 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116006563 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1534 (D1534G)
Ref Sequence ENSEMBL: ENSMUSP00000127604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021107] [ENSMUST00000021114] [ENSMUST00000068981] [ENSMUST00000106458] [ENSMUST00000106460] [ENSMUST00000106461] [ENSMUST00000169928]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021107
AA Change: D1534G

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021107
Gene: ENSMUSG00000020758
AA Change: D1534G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 712 1.32e-28 SMART
low complexity region 715 732 N/A INTRINSIC
transmembrane domain 737 756 N/A INTRINSIC
Calx_beta 980 1085 3.13e-35 SMART
FN3 1125 1203 3.15e-8 SMART
FN3 1218 1305 6.29e-8 SMART
low complexity region 1324 1332 N/A INTRINSIC
FN3 1508 1589 1.79e-12 SMART
FN3 1621 1705 1.7e-13 SMART
low complexity region 1738 1751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021114
SMART Domains Protein: ENSMUSP00000021114
Gene: ENSMUSG00000020766

DomainStartEndE-ValueType
Pfam:GalKase_gal_bdg 18 67 2.6e-24 PFAM
Pfam:GHMP_kinases_N 126 194 7.3e-14 PFAM
Pfam:GHMP_kinases_C 289 374 1.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068981
AA Change: D1485G

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070811
Gene: ENSMUSG00000020758
AA Change: D1485G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
FN3 1459 1540 1.79e-12 SMART
FN3 1572 1656 1.7e-13 SMART
low complexity region 1689 1702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106458
AA Change: D1550G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102066
Gene: ENSMUSG00000020758
AA Change: D1550G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
low complexity region 1413 1425 N/A INTRINSIC
FN3 1524 1605 1.79e-12 SMART
FN3 1637 1721 1.7e-13 SMART
low complexity region 1754 1767 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106460
AA Change: D1538G

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102068
Gene: ENSMUSG00000020758
AA Change: D1538G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
FN3 1512 1593 1.79e-12 SMART
FN3 1625 1709 1.7e-13 SMART
low complexity region 1742 1755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106461
AA Change: D1550G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102069
Gene: ENSMUSG00000020758
AA Change: D1550G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
low complexity region 1413 1425 N/A INTRINSIC
FN3 1524 1605 1.79e-12 SMART
FN3 1637 1721 1.7e-13 SMART
low complexity region 1754 1767 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169928
AA Change: D1534G

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127604
Gene: ENSMUSG00000020758
AA Change: D1534G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 712 1.32e-28 SMART
low complexity region 715 732 N/A INTRINSIC
transmembrane domain 737 756 N/A INTRINSIC
Calx_beta 980 1085 3.13e-35 SMART
FN3 1125 1203 3.15e-8 SMART
FN3 1218 1305 6.29e-8 SMART
low complexity region 1324 1332 N/A INTRINSIC
FN3 1508 1589 1.79e-12 SMART
FN3 1621 1705 1.7e-13 SMART
low complexity region 1738 1751 N/A INTRINSIC
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Integrins are heterodimers comprised of alpha and beta subunits, that are noncovalently associated transmembrane glycoprotein receptors. Different combinations of alpha and beta polypeptides form complexes that vary in their ligand-binding specificities. Integrins mediate cell-matrix or cell-cell adhesion, and transduced signals that regulate gene expression and cell growth. This gene encodes the integrin beta 4 subunit, a receptor for the laminins. This subunit tends to associate with alpha 6 subunit and is likely to play a pivotal role in the biology of invasive carcinoma. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die shortly after birth with extensive detachment of the epidermis and other squamus epithelia. Stratified tissues lack hemidesmosomes and simple epithelia are also defective in adherence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,283,089 L1158P probably damaging Het
Acnat1 A T 4: 49,451,077 N11K possibly damaging Het
Ammecr1l T A 18: 31,776,003 I217N possibly damaging Het
Ankrd11 G A 8: 122,908,734 R54* probably null Het
Ccdc178 C T 18: 22,131,414 probably null Het
Ccdc36 G T 9: 108,413,006 T133N possibly damaging Het
Clcn7 T C 17: 25,153,140 S425P probably benign Het
Cnmd A G 14: 79,656,605 V114A probably damaging Het
Col13a1 T C 10: 61,851,162 T651A unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp3a25 T C 5: 145,986,968 probably null Het
Dmrta1 A T 4: 89,691,616 D271V probably benign Het
Efcab3 T A 11: 105,072,318 probably null Het
Exo5 T C 4: 120,921,997 I224V probably damaging Het
Fam162b C A 10: 51,587,218 A118S probably damaging Het
Glb1 A G 9: 114,454,257 T406A possibly damaging Het
Grk3 T C 5: 112,914,983 N666S probably benign Het
Hars2 T C 18: 36,789,523 F370L possibly damaging Het
Ighv8-11 T G 12: 115,567,603 probably benign Het
Inpp4b A T 8: 81,997,339 D500V probably benign Het
Kcnk2 G C 1: 189,340,017 T38S possibly damaging Het
Kif16b C T 2: 142,756,122 V527I probably benign Het
Kmt2b A G 7: 30,576,708 Y1789H probably damaging Het
Lpl A C 8: 68,901,243 D412A possibly damaging Het
Lrrc27 T G 7: 139,223,613 L151R probably damaging Het
Muc3 T C 5: 137,154,041 probably benign Het
Nup205 T A 6: 35,208,134 Y829* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfm4 A G 14: 80,021,752 Y447C probably damaging Het
Olfr1308 T C 2: 111,960,149 Y308C probably benign Het
Pcdhb6 T C 18: 37,335,169 V381A probably benign Het
Prmt2 C T 10: 76,225,415 W79* probably null Het
Skiv2l T C 17: 34,840,385 M1029V probably benign Het
Stil A G 4: 115,016,286 R369G probably null Het
Ttc41 T C 10: 86,724,374 I387T probably benign Het
Tubgcp6 A G 15: 89,102,984 L1262P probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp804b T C 5: 6,769,445 H1206R probably damaging Het
Other mutations in Itgb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Itgb4 APN 11 115990940 missense probably damaging 1.00
IGL01391:Itgb4 APN 11 115990920 missense probably damaging 1.00
IGL01431:Itgb4 APN 11 116006457 splice site probably benign
IGL01750:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01752:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01756:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01766:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01769:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02188:Itgb4 APN 11 116003387 missense probably benign 0.08
IGL02262:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02293:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02318:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02319:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02338:Itgb4 APN 11 116007969 missense probably damaging 1.00
IGL02734:Itgb4 APN 11 116005966 missense probably benign
IGL02879:Itgb4 APN 11 115994352 missense probably benign 0.05
IGL02889:Itgb4 APN 11 115988905 missense probably damaging 1.00
IGL03183:Itgb4 APN 11 115988724 missense probably damaging 1.00
IGL03054:Itgb4 UTSW 11 116000340 nonsense probably null
R0021:Itgb4 UTSW 11 115979627 missense possibly damaging 0.95
R0092:Itgb4 UTSW 11 115979124 missense probably damaging 1.00
R0305:Itgb4 UTSW 11 115979412 missense probably damaging 1.00
R0408:Itgb4 UTSW 11 116007602 missense probably damaging 0.99
R0465:Itgb4 UTSW 11 115979756 missense probably damaging 1.00
R0499:Itgb4 UTSW 11 115979695 missense probably benign 0.00
R0535:Itgb4 UTSW 11 115991009 missense possibly damaging 0.86
R0571:Itgb4 UTSW 11 115979768 missense possibly damaging 0.94
R0613:Itgb4 UTSW 11 115993342 missense probably damaging 0.98
R0838:Itgb4 UTSW 11 115998162 intron probably benign
R1381:Itgb4 UTSW 11 115994337 missense probably benign 0.00
R1451:Itgb4 UTSW 11 115990884 missense probably damaging 1.00
R1459:Itgb4 UTSW 11 115979111 missense probably benign 0.42
R1460:Itgb4 UTSW 11 115984164 missense probably damaging 0.96
R1473:Itgb4 UTSW 11 115984047 missense probably benign 0.01
R1484:Itgb4 UTSW 11 115999799 missense probably benign 0.01
R1593:Itgb4 UTSW 11 115980991 missense probably damaging 1.00
R1623:Itgb4 UTSW 11 115991316 nonsense probably null
R1633:Itgb4 UTSW 11 116007760 missense probably damaging 1.00
R1642:Itgb4 UTSW 11 116007357 missense probably damaging 1.00
R1669:Itgb4 UTSW 11 115991330 missense probably benign 0.07
R1713:Itgb4 UTSW 11 116003489 missense probably damaging 1.00
R1732:Itgb4 UTSW 11 115988918 missense probably damaging 1.00
R1791:Itgb4 UTSW 11 115988520 missense probably damaging 1.00
R1847:Itgb4 UTSW 11 115983764 missense probably benign 0.31
R1902:Itgb4 UTSW 11 115980738 missense probably damaging 0.98
R1945:Itgb4 UTSW 11 115993453 nonsense probably null
R2102:Itgb4 UTSW 11 116005735 missense probably benign 0.23
R2184:Itgb4 UTSW 11 115979624 missense probably damaging 0.96
R2334:Itgb4 UTSW 11 115993435 missense probably damaging 1.00
R3743:Itgb4 UTSW 11 116003670 missense probably damaging 1.00
R3938:Itgb4 UTSW 11 116005926 missense possibly damaging 0.92
R4134:Itgb4 UTSW 11 116006470 missense probably benign 0.03
R4280:Itgb4 UTSW 11 115990935 missense probably damaging 1.00
R4342:Itgb4 UTSW 11 115988729 missense probably benign 0.01
R4434:Itgb4 UTSW 11 115999814 missense probably benign 0.10
R4505:Itgb4 UTSW 11 115983261 splice site silent
R4585:Itgb4 UTSW 11 115993325 missense probably damaging 1.00
R4586:Itgb4 UTSW 11 115993325 missense probably damaging 1.00
R4601:Itgb4 UTSW 11 116005722 missense probably damaging 1.00
R4921:Itgb4 UTSW 11 116006605 missense probably benign 0.12
R4962:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5027:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5029:Itgb4 UTSW 11 115988591 intron probably benign
R5084:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5085:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5124:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5125:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5150:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5175:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5176:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5179:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5207:Itgb4 UTSW 11 116006539 missense probably damaging 1.00
R5263:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5264:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5334:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5337:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5344:Itgb4 UTSW 11 115989749 missense probably null 0.92
R5391:Itgb4 UTSW 11 115985068 missense probably benign 0.05
R5437:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5440:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5653:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5654:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5655:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5772:Itgb4 UTSW 11 115988432 intron probably benign
R5812:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5813:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5814:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5863:Itgb4 UTSW 11 115990922 missense probably damaging 1.00
R5864:Itgb4 UTSW 11 115990922 missense probably damaging 1.00
R5865:Itgb4 UTSW 11 115990922 missense probably damaging 1.00
R5951:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5954:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5982:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6043:Itgb4 UTSW 11 115979386 missense probably benign 0.30
R6133:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6134:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6135:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6169:Itgb4 UTSW 11 115994276 missense probably damaging 0.98
R6172:Itgb4 UTSW 11 116000411 missense probably benign 0.23
R6255:Itgb4 UTSW 11 115998137 missense possibly damaging 0.83
R6258:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6259:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6260:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6612:Itgb4 UTSW 11 115984071 missense probably benign 0.00
R7037:Itgb4 UTSW 11 116005565 nonsense probably null
X0062:Itgb4 UTSW 11 115993452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATAATATGACTGGAGAGGC -3'
(R):5'- CTATTCCAGTTAGCAGAGGCCC -3'

Sequencing Primer
(F):5'- CAAGCACGGGGTAGACTGTAGC -3'
(R):5'- AGTTAGCAGAGGCCCTAGGTCTAC -3'
Posted On2014-11-11