Incidental Mutation 'R2401:Clcn7'
ID 248710
Institutional Source Beutler Lab
Gene Symbol Clcn7
Ensembl Gene ENSMUSG00000036636
Gene Name chloride channel, voltage-sensitive 7
Synonyms ClC-7
MMRRC Submission 040367-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2401 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 25352365-25381078 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25372114 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 425 (S425P)
Ref Sequence ENSEMBL: ENSMUSP00000124194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000160961]
AlphaFold O70496
Predicted Effect probably benign
Transcript: ENSMUST00000040729
AA Change: S445P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636
AA Change: S445P

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Voltage_CLC 183 594 1.5e-96 PFAM
CBS 632 687 8.38e-4 SMART
CBS 742 790 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159773
SMART Domains Protein: ENSMUSP00000125546
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
Pfam:Voltage_CLC 76 202 5.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160961
AA Change: S425P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636
AA Change: S425P

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
Pfam:Voltage_CLC 163 574 1.5e-93 PFAM
CBS 612 667 8.38e-4 SMART
CBS 722 770 1.77e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161153
Predicted Effect unknown
Transcript: ENSMUST00000162862
AA Change: S100P
SMART Domains Protein: ENSMUSP00000124527
Gene: ENSMUSG00000036636
AA Change: S100P

DomainStartEndE-ValueType
Pfam:Voltage_CLC 5 307 1.3e-48 PFAM
Meta Mutation Damage Score 0.2442 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CLC chloride channel family of proteins. Chloride channels play important roles in the plasma membrane and in intracellular organelles. This gene encodes chloride channel 7. Defects in this gene are the cause of osteopetrosis autosomal recessive type 4 (OPTB4), also called infantile malignant osteopetrosis type 2 as well as the cause of autosomal dominant osteopetrosis type 2 (OPTA2), also called autosomal dominant Albers-Schonberg disease or marble disease autosoml dominant. Osteopetrosis is a rare genetic disease characterized by abnormally dense bone, due to defective resorption of immature bone. OPTA2 is the most common form of osteopetrosis, occurring in adolescence or adulthood. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal bone formation, including osteopetrosis, and retinal degeneration. Mice homozygous for a conditional allele exhibit lysosomal defects with neuronal degeneration and accumulationof giant lysosomes in renal tubule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,882,312 (GRCm39) L1158P probably damaging Het
Acnat1 A T 4: 49,451,077 (GRCm39) N11K possibly damaging Het
Ammecr1l T A 18: 31,909,056 (GRCm39) I217N possibly damaging Het
Ankrd11 G A 8: 123,635,473 (GRCm39) R54* probably null Het
Ccdc178 C T 18: 22,264,471 (GRCm39) probably null Het
Cnmd A G 14: 79,894,045 (GRCm39) V114A probably damaging Het
Col13a1 T C 10: 61,686,941 (GRCm39) T651A unknown Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Cyp3a25 T C 5: 145,923,778 (GRCm39) probably null Het
Dmrta1 A T 4: 89,579,853 (GRCm39) D271V probably benign Het
Efcab3 T A 11: 104,963,144 (GRCm39) probably null Het
Exo5 T C 4: 120,779,194 (GRCm39) I224V probably damaging Het
Fam162b C A 10: 51,463,314 (GRCm39) A118S probably damaging Het
Glb1 A G 9: 114,283,325 (GRCm39) T406A possibly damaging Het
Grk3 T C 5: 113,062,849 (GRCm39) N666S probably benign Het
Hars2 T C 18: 36,922,576 (GRCm39) F370L possibly damaging Het
Ighv8-11 T G 12: 115,531,223 (GRCm39) probably benign Het
Iho1 G T 9: 108,290,205 (GRCm39) T133N possibly damaging Het
Inpp4b A T 8: 82,723,968 (GRCm39) D500V probably benign Het
Itgb4 A G 11: 115,897,389 (GRCm39) D1534G possibly damaging Het
Kcnk2 G C 1: 189,072,214 (GRCm39) T38S possibly damaging Het
Kif16b C T 2: 142,598,042 (GRCm39) V527I probably benign Het
Kmt2b A G 7: 30,276,133 (GRCm39) Y1789H probably damaging Het
Lpl A C 8: 69,353,895 (GRCm39) D412A possibly damaging Het
Lrrc27 T G 7: 138,803,529 (GRCm39) L151R probably damaging Het
Muc17 T C 5: 137,190,980 (GRCm39) probably benign Het
Nup205 T A 6: 35,185,069 (GRCm39) Y829* probably null Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Olfm4 A G 14: 80,259,192 (GRCm39) Y447C probably damaging Het
Or4f57 T C 2: 111,790,494 (GRCm39) Y308C probably benign Het
Pcdhb6 T C 18: 37,468,222 (GRCm39) V381A probably benign Het
Prmt2 C T 10: 76,061,249 (GRCm39) W79* probably null Het
Skic2 T C 17: 35,059,361 (GRCm39) M1029V probably benign Het
Stil A G 4: 114,873,483 (GRCm39) R369G probably null Het
Ttc41 T C 10: 86,560,238 (GRCm39) I387T probably benign Het
Tubgcp6 A G 15: 88,987,187 (GRCm39) L1262P probably benign Het
Vmn2r112 T A 17: 22,822,096 (GRCm39) V258E probably damaging Het
Zfp804b T C 5: 6,819,445 (GRCm39) H1206R probably damaging Het
Other mutations in Clcn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clcn7 APN 17 25,370,097 (GRCm39) missense probably damaging 1.00
IGL01735:Clcn7 APN 17 25,370,090 (GRCm39) missense probably benign 0.13
IGL01912:Clcn7 APN 17 25,371,983 (GRCm39) splice site probably benign
IGL01936:Clcn7 APN 17 25,374,350 (GRCm39) missense probably benign 0.44
IGL02084:Clcn7 APN 17 25,376,899 (GRCm39) missense probably benign
IGL02121:Clcn7 APN 17 25,372,058 (GRCm39) missense possibly damaging 0.95
IGL02160:Clcn7 APN 17 25,368,004 (GRCm39) unclassified probably benign
IGL02335:Clcn7 APN 17 25,365,821 (GRCm39) missense probably benign 0.00
IGL02507:Clcn7 APN 17 25,363,443 (GRCm39) missense probably damaging 1.00
IGL02605:Clcn7 APN 17 25,365,792 (GRCm39) missense possibly damaging 0.60
IGL03160:Clcn7 APN 17 25,365,427 (GRCm39) unclassified probably benign
IGL03192:Clcn7 APN 17 25,352,575 (GRCm39) missense probably benign 0.00
IGL03194:Clcn7 APN 17 25,369,522 (GRCm39) missense probably damaging 0.98
IGL03409:Clcn7 APN 17 25,374,359 (GRCm39) missense probably damaging 1.00
R0140:Clcn7 UTSW 17 25,372,728 (GRCm39) missense probably damaging 1.00
R0153:Clcn7 UTSW 17 25,368,176 (GRCm39) unclassified probably benign
R0970:Clcn7 UTSW 17 25,370,208 (GRCm39) critical splice donor site probably null
R1644:Clcn7 UTSW 17 25,378,672 (GRCm39) missense probably damaging 1.00
R1856:Clcn7 UTSW 17 25,379,445 (GRCm39) missense probably damaging 1.00
R2145:Clcn7 UTSW 17 25,363,425 (GRCm39) missense probably benign
R2173:Clcn7 UTSW 17 25,364,583 (GRCm39) missense probably benign
R2511:Clcn7 UTSW 17 25,374,420 (GRCm39) missense probably damaging 1.00
R3683:Clcn7 UTSW 17 25,369,567 (GRCm39) missense possibly damaging 0.84
R3684:Clcn7 UTSW 17 25,369,567 (GRCm39) missense possibly damaging 0.84
R3694:Clcn7 UTSW 17 25,378,681 (GRCm39) missense probably damaging 0.99
R4424:Clcn7 UTSW 17 25,379,150 (GRCm39) missense probably damaging 1.00
R4681:Clcn7 UTSW 17 25,376,935 (GRCm39) missense probably damaging 1.00
R4870:Clcn7 UTSW 17 25,372,539 (GRCm39) intron probably benign
R5372:Clcn7 UTSW 17 25,376,153 (GRCm39) missense possibly damaging 0.82
R5820:Clcn7 UTSW 17 25,368,026 (GRCm39) missense probably damaging 1.00
R6154:Clcn7 UTSW 17 25,376,928 (GRCm39) missense probably damaging 0.98
R6181:Clcn7 UTSW 17 25,370,702 (GRCm39) missense possibly damaging 0.79
R6306:Clcn7 UTSW 17 25,376,502 (GRCm39) missense probably benign 0.01
R6798:Clcn7 UTSW 17 25,378,734 (GRCm39) missense probably damaging 1.00
R6961:Clcn7 UTSW 17 25,376,188 (GRCm39) missense probably damaging 1.00
R7020:Clcn7 UTSW 17 25,365,325 (GRCm39) missense possibly damaging 0.76
R7089:Clcn7 UTSW 17 25,372,667 (GRCm39) missense
R7757:Clcn7 UTSW 17 25,375,796 (GRCm39) missense probably damaging 1.00
R8057:Clcn7 UTSW 17 25,368,233 (GRCm39) nonsense probably null
R8670:Clcn7 UTSW 17 25,378,588 (GRCm39) missense probably damaging 0.99
R9031:Clcn7 UTSW 17 25,376,497 (GRCm39) missense probably damaging 0.96
R9720:Clcn7 UTSW 17 25,374,471 (GRCm39) missense probably damaging 1.00
X0020:Clcn7 UTSW 17 25,369,200 (GRCm39) missense probably damaging 1.00
Z1177:Clcn7 UTSW 17 25,371,989 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCATCAATGGGTTCTGGGTC -3'
(R):5'- TTTGGTGAGATCACTCTAGTACCC -3'

Sequencing Primer
(F):5'- GCAGATGAGGCTACTGTCC -3'
(R):5'- GTGAGATCACTCTAGTACCCACTCC -3'
Posted On 2014-11-11