Incidental Mutation 'R2402:Olfr914'
ID248758
Institutional Source Beutler Lab
Gene Symbol Olfr914
Ensembl Gene ENSMUSG00000047050
Gene Nameolfactory receptor 914
SynonymsMOR165-7, GA_x6K02T2PVTD-32308823-32309773
MMRRC Submission 040368-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2402 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38605102-38610978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38607101 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 212 (V212A)
Ref Sequence ENSEMBL: ENSMUSP00000150241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057755] [ENSMUST00000217057]
Predicted Effect probably benign
Transcript: ENSMUST00000057755
AA Change: V212A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000053405
Gene: ENSMUSG00000047050
AA Change: V212A

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 1.1e-48 PFAM
Pfam:7tm_1 41 290 5.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217057
AA Change: V212A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 86,509,141 D1199V probably damaging Het
Abcc6 A T 7: 46,015,575 S277R probably benign Het
Acvrl1 A G 15: 101,137,399 S269G probably damaging Het
Aes T A 10: 81,564,878 C89S possibly damaging Het
Akap10 T C 11: 61,915,222 S227G probably benign Het
Angptl8 T C 9: 21,835,816 probably null Het
Arsi T C 18: 60,916,467 S141P possibly damaging Het
Atic T A 1: 71,569,057 Y303* probably null Het
Bbs9 C T 9: 22,646,063 P510L probably benign Het
Bcl2a1b A G 9: 89,199,742 N128S probably benign Het
Bcl2a1d A T 9: 88,731,496 M75K probably damaging Het
Carm1 T A 9: 21,583,540 L324Q probably damaging Het
Caskin1 T A 17: 24,503,808 L550Q probably damaging Het
Cd302 A G 2: 60,257,068 I142T probably benign Het
Cep350 A T 1: 155,863,136 D2320E probably benign Het
Cgnl1 A G 9: 71,725,179 S297P probably damaging Het
Cr1l T A 1: 195,106,902 Y398F probably benign Het
Ctsa A T 2: 164,834,893 D145V probably benign Het
Ctsj C T 13: 61,000,574 G303D probably damaging Het
Dnah17 T C 11: 118,125,974 I250M probably benign Het
Doc2a C A 7: 126,848,747 C54* probably null Het
Dpy19l2 T C 9: 24,581,248 T685A probably damaging Het
Dtna T A 18: 23,595,478 C243* probably null Het
Exoc3l4 A G 12: 111,422,256 T60A possibly damaging Het
Exph5 C A 9: 53,374,925 S1102* probably null Het
Fam129a A G 1: 151,689,614 T232A probably benign Het
Fhl3 T C 4: 124,705,688 Y19H probably damaging Het
Flt4 A G 11: 49,637,819 E1012G possibly damaging Het
Flvcr2 A G 12: 85,783,003 N262S probably benign Het
Gon4l G T 3: 88,859,043 C463F probably damaging Het
H2-T10 A T 17: 36,117,739 probably null Het
Heatr3 T C 8: 88,144,572 C185R probably benign Het
Hectd1 A G 12: 51,745,534 V2474A probably benign Het
Htr3a C T 9: 48,901,495 E215K probably damaging Het
Ica1l T C 1: 60,006,292 T271A probably benign Het
Klra2 A G 6: 131,243,901 I66T probably benign Het
Neto2 T C 8: 85,690,912 K21R probably benign Het
Nisch T A 14: 31,185,014 probably benign Het
Nr4a1 G T 15: 101,271,737 R296L probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr832 T A 9: 18,945,200 I184N probably damaging Het
Pcsk5 A T 19: 17,474,834 C1102* probably null Het
Phip C T 9: 82,875,305 A1605T probably benign Het
Pstpip2 T A 18: 77,854,864 M105K possibly damaging Het
Qprt C T 7: 127,108,360 V219I probably benign Het
Ralgapa2 A T 2: 146,353,192 N1271K probably damaging Het
Reg3g A T 6: 78,467,492 L106H probably damaging Het
Rhobtb1 G A 10: 69,270,424 G273D probably benign Het
Rimbp2 T C 5: 128,784,888 D771G probably damaging Het
Sos2 T C 12: 69,596,799 I935V possibly damaging Het
Tcf12 A T 9: 71,856,510 N397K probably damaging Het
Tgtp2 T C 11: 49,059,130 Q205R probably benign Het
Tubb2b T C 13: 34,128,226 N195D probably benign Het
Unc13b A G 4: 43,095,843 T84A probably benign Het
Usb1 T A 8: 95,343,131 F102L probably benign Het
Vmn2r61 A G 7: 42,300,105 T650A possibly damaging Het
Zbtb41 A C 1: 139,423,185 D12A probably benign Het
Zbtb41 G T 1: 139,423,187 E13* probably null Het
Zfp821 C T 8: 109,721,240 S71F probably damaging Het
Other mutations in Olfr914
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Olfr914 APN 9 38606554 missense probably null 0.00
IGL01758:Olfr914 APN 9 38607293 missense probably damaging 0.99
IGL02003:Olfr914 APN 9 38606840 missense probably damaging 1.00
IGL02203:Olfr914 APN 9 38607423 utr 3 prime probably benign
IGL02233:Olfr914 APN 9 38607242 missense probably damaging 1.00
IGL02408:Olfr914 APN 9 38607121 missense possibly damaging 0.62
IGL02882:Olfr914 APN 9 38606938 missense probably benign 0.04
IGL03081:Olfr914 APN 9 38606870 missense probably benign 0.01
IGL03088:Olfr914 APN 9 38607301 missense probably damaging 0.99
IGL03177:Olfr914 APN 9 38606571 nonsense probably null
IGL03219:Olfr914 APN 9 38606951 missense probably benign 0.28
P0023:Olfr914 UTSW 9 38606645 missense probably damaging 1.00
R0630:Olfr914 UTSW 9 38606896 missense probably benign 0.01
R0948:Olfr914 UTSW 9 38606491 missense possibly damaging 0.65
R1451:Olfr914 UTSW 9 38606938 missense probably benign 0.04
R1681:Olfr914 UTSW 9 38606948 missense probably damaging 0.99
R5854:Olfr914 UTSW 9 38606663 missense probably damaging 1.00
R6857:Olfr914 UTSW 9 38607011 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCCATGATCCACACAGGTTG -3'
(R):5'- CTGTAGATTAGAGGGTTCATCATGG -3'

Sequencing Primer
(F):5'- CACAGGTTGTGTAATGAGACTGACC -3'
(R):5'- GGAAGAGAACTTTGCCTCATTC -3'
Posted On2014-11-11