Incidental Mutation 'R2402:Exph5'
ID 248760
Institutional Source Beutler Lab
Gene Symbol Exph5
Ensembl Gene ENSMUSG00000034584
Gene Name exophilin 5
Synonyms AC079869.22gm5, Slac2b, slac2-b, B130009M24Rik
MMRRC Submission 040368-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2402 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 53212970-53288814 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 53286225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 1102 (S1102*)
Ref Sequence ENSEMBL: ENSMUSP00000062632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051014]
AlphaFold Q0VAV2
Predicted Effect probably null
Transcript: ENSMUST00000051014
AA Change: S1102*
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: S1102*

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 87,235,770 (GRCm39) D1199V probably damaging Het
Abcc6 A T 7: 45,664,999 (GRCm39) S277R probably benign Het
Acvrl1 A G 15: 101,035,280 (GRCm39) S269G probably damaging Het
Akap10 T C 11: 61,806,048 (GRCm39) S227G probably benign Het
Angptl8 T C 9: 21,747,112 (GRCm39) probably null Het
Arsi T C 18: 61,049,539 (GRCm39) S141P possibly damaging Het
Atic T A 1: 71,608,216 (GRCm39) Y303* probably null Het
Bbs9 C T 9: 22,557,359 (GRCm39) P510L probably benign Het
Bcl2a1b A G 9: 89,081,795 (GRCm39) N128S probably benign Het
Bcl2a1d A T 9: 88,613,549 (GRCm39) M75K probably damaging Het
Carm1 T A 9: 21,494,836 (GRCm39) L324Q probably damaging Het
Caskin1 T A 17: 24,722,782 (GRCm39) L550Q probably damaging Het
Cd302 A G 2: 60,087,412 (GRCm39) I142T probably benign Het
Cep350 A T 1: 155,738,882 (GRCm39) D2320E probably benign Het
Cgnl1 A G 9: 71,632,461 (GRCm39) S297P probably damaging Het
Cr1l T A 1: 194,789,210 (GRCm39) Y398F probably benign Het
Ctsa A T 2: 164,676,813 (GRCm39) D145V probably benign Het
Ctsj C T 13: 61,148,388 (GRCm39) G303D probably damaging Het
Dnah17 T C 11: 118,016,800 (GRCm39) I250M probably benign Het
Doc2a C A 7: 126,447,919 (GRCm39) C54* probably null Het
Dpy19l2 T C 9: 24,492,544 (GRCm39) T685A probably damaging Het
Dtna T A 18: 23,728,535 (GRCm39) C243* probably null Het
Exoc3l4 A G 12: 111,388,690 (GRCm39) T60A possibly damaging Het
Fhl3 T C 4: 124,599,481 (GRCm39) Y19H probably damaging Het
Flt4 A G 11: 49,528,646 (GRCm39) E1012G possibly damaging Het
Flvcr2 A G 12: 85,829,777 (GRCm39) N262S probably benign Het
Gon4l G T 3: 88,766,350 (GRCm39) C463F probably damaging Het
H2-T10 A T 17: 36,428,631 (GRCm39) probably null Het
Heatr3 T C 8: 88,871,200 (GRCm39) C185R probably benign Het
Hectd1 A G 12: 51,792,317 (GRCm39) V2474A probably benign Het
Htr3a C T 9: 48,812,795 (GRCm39) E215K probably damaging Het
Ica1l T C 1: 60,045,451 (GRCm39) T271A probably benign Het
Klra2 A G 6: 131,220,864 (GRCm39) I66T probably benign Het
Neto2 T C 8: 86,417,541 (GRCm39) K21R probably benign Het
Niban1 A G 1: 151,565,365 (GRCm39) T232A probably benign Het
Nisch T A 14: 30,906,971 (GRCm39) probably benign Het
Nr4a1 G T 15: 101,169,618 (GRCm39) R296L probably damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or7g19 T A 9: 18,856,496 (GRCm39) I184N probably damaging Het
Or8b50 T C 9: 38,518,397 (GRCm39) V212A probably benign Het
Pcsk5 A T 19: 17,452,198 (GRCm39) C1102* probably null Het
Phip C T 9: 82,757,358 (GRCm39) A1605T probably benign Het
Pstpip2 T A 18: 77,942,564 (GRCm39) M105K possibly damaging Het
Qprt C T 7: 126,707,532 (GRCm39) V219I probably benign Het
Ralgapa2 A T 2: 146,195,112 (GRCm39) N1271K probably damaging Het
Reg3g A T 6: 78,444,475 (GRCm39) L106H probably damaging Het
Rhobtb1 G A 10: 69,106,254 (GRCm39) G273D probably benign Het
Rimbp2 T C 5: 128,861,952 (GRCm39) D771G probably damaging Het
Sos2 T C 12: 69,643,573 (GRCm39) I935V possibly damaging Het
Tcf12 A T 9: 71,763,792 (GRCm39) N397K probably damaging Het
Tgtp2 T C 11: 48,949,957 (GRCm39) Q205R probably benign Het
Tle5 T A 10: 81,400,712 (GRCm39) C89S possibly damaging Het
Tubb2b T C 13: 34,312,209 (GRCm39) N195D probably benign Het
Unc13b A G 4: 43,095,843 (GRCm39) T84A probably benign Het
Usb1 T A 8: 96,069,759 (GRCm39) F102L probably benign Het
Vmn2r61 A G 7: 41,949,529 (GRCm39) T650A possibly damaging Het
Zbtb41 A C 1: 139,350,923 (GRCm39) D12A probably benign Het
Zbtb41 G T 1: 139,350,925 (GRCm39) E13* probably null Het
Zfp821 C T 8: 110,447,872 (GRCm39) S71F probably damaging Het
Other mutations in Exph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Exph5 APN 9 53,288,006 (GRCm39) nonsense probably null
IGL01387:Exph5 APN 9 53,285,265 (GRCm39) missense possibly damaging 0.95
IGL01985:Exph5 APN 9 53,287,869 (GRCm39) missense probably damaging 0.99
IGL02122:Exph5 APN 9 53,284,974 (GRCm39) missense probably benign 0.05
IGL02156:Exph5 APN 9 53,286,941 (GRCm39) missense probably damaging 0.96
IGL02192:Exph5 APN 9 53,287,625 (GRCm39) nonsense probably null
IGL02491:Exph5 APN 9 53,286,343 (GRCm39) missense possibly damaging 0.89
PIT4802001:Exph5 UTSW 9 53,286,278 (GRCm39) missense probably damaging 0.96
R0002:Exph5 UTSW 9 53,285,256 (GRCm39) missense probably damaging 0.99
R0026:Exph5 UTSW 9 53,287,779 (GRCm39) missense probably benign 0.38
R0086:Exph5 UTSW 9 53,249,230 (GRCm39) missense possibly damaging 0.90
R0152:Exph5 UTSW 9 53,264,504 (GRCm39) critical splice donor site probably null
R0369:Exph5 UTSW 9 53,284,602 (GRCm39) missense probably benign 0.35
R0409:Exph5 UTSW 9 53,285,643 (GRCm39) missense probably benign 0.00
R0517:Exph5 UTSW 9 53,284,062 (GRCm39) missense probably benign 0.02
R0658:Exph5 UTSW 9 53,288,775 (GRCm39) missense unknown
R1606:Exph5 UTSW 9 53,285,595 (GRCm39) missense probably benign 0.37
R1739:Exph5 UTSW 9 53,286,888 (GRCm39) missense possibly damaging 0.62
R1769:Exph5 UTSW 9 53,285,109 (GRCm39) missense probably benign 0.35
R1828:Exph5 UTSW 9 53,287,941 (GRCm39) missense possibly damaging 0.79
R1862:Exph5 UTSW 9 53,287,548 (GRCm39) missense probably benign
R1993:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R2012:Exph5 UTSW 9 53,278,466 (GRCm39) missense possibly damaging 0.49
R2044:Exph5 UTSW 9 53,283,979 (GRCm39) missense possibly damaging 0.79
R3817:Exph5 UTSW 9 53,286,794 (GRCm39) nonsense probably null
R4771:Exph5 UTSW 9 53,284,965 (GRCm39) missense possibly damaging 0.95
R4869:Exph5 UTSW 9 53,287,539 (GRCm39) missense possibly damaging 0.73
R4926:Exph5 UTSW 9 53,287,925 (GRCm39) missense possibly damaging 0.95
R4996:Exph5 UTSW 9 53,286,910 (GRCm39) missense possibly damaging 0.79
R5254:Exph5 UTSW 9 53,249,230 (GRCm39) missense probably damaging 0.99
R5522:Exph5 UTSW 9 53,285,613 (GRCm39) missense possibly damaging 0.90
R5947:Exph5 UTSW 9 53,286,522 (GRCm39) missense probably benign 0.04
R5961:Exph5 UTSW 9 53,288,555 (GRCm39) missense probably damaging 1.00
R6093:Exph5 UTSW 9 53,283,917 (GRCm39) missense possibly damaging 0.94
R6144:Exph5 UTSW 9 53,284,328 (GRCm39) missense probably benign 0.21
R6254:Exph5 UTSW 9 53,284,010 (GRCm39) missense possibly damaging 0.81
R6279:Exph5 UTSW 9 53,285,246 (GRCm39) missense possibly damaging 0.78
R6300:Exph5 UTSW 9 53,285,246 (GRCm39) missense possibly damaging 0.78
R6485:Exph5 UTSW 9 53,287,991 (GRCm39) missense possibly damaging 0.89
R6553:Exph5 UTSW 9 53,213,012 (GRCm39) start gained probably benign
R6792:Exph5 UTSW 9 53,286,617 (GRCm39) missense possibly damaging 0.52
R7026:Exph5 UTSW 9 53,251,728 (GRCm39) missense probably benign 0.27
R7340:Exph5 UTSW 9 53,288,309 (GRCm39) missense probably damaging 0.99
R7347:Exph5 UTSW 9 53,287,196 (GRCm39) missense possibly damaging 0.79
R7352:Exph5 UTSW 9 53,287,022 (GRCm39) missense probably benign 0.00
R7520:Exph5 UTSW 9 53,278,514 (GRCm39) critical splice donor site probably null
R7521:Exph5 UTSW 9 53,285,377 (GRCm39) missense possibly damaging 0.89
R7560:Exph5 UTSW 9 53,287,073 (GRCm39) missense probably benign 0.41
R7581:Exph5 UTSW 9 53,283,857 (GRCm39) missense possibly damaging 0.90
R7726:Exph5 UTSW 9 53,284,475 (GRCm39) missense possibly damaging 0.62
R7976:Exph5 UTSW 9 53,287,935 (GRCm39) missense possibly damaging 0.79
R8017:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8019:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8302:Exph5 UTSW 9 53,287,776 (GRCm39) missense possibly damaging 0.89
R8420:Exph5 UTSW 9 53,287,148 (GRCm39) nonsense probably null
R8551:Exph5 UTSW 9 53,285,351 (GRCm39) missense possibly damaging 0.94
R8708:Exph5 UTSW 9 53,287,096 (GRCm39) missense probably benign
R8889:Exph5 UTSW 9 53,287,955 (GRCm39) missense probably damaging 1.00
R9048:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R9255:Exph5 UTSW 9 53,284,609 (GRCm39) missense possibly damaging 0.79
R9727:Exph5 UTSW 9 53,287,702 (GRCm39) missense probably damaging 0.96
X0028:Exph5 UTSW 9 53,287,563 (GRCm39) missense probably damaging 1.00
Z1177:Exph5 UTSW 9 53,288,719 (GRCm39) missense probably benign
Z1177:Exph5 UTSW 9 53,285,513 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TTAGGAATGGGCCACTTCCC -3'
(R):5'- AGTGTGTTCTTGAGCAAGTTCC -3'

Sequencing Primer
(F):5'- GTGATGCTGCAAATGCAG -3'
(R):5'- ACGATGGTTCACCTTCCAGAGAG -3'
Posted On 2014-11-11