Incidental Mutation 'R2403:Clcn1'
ID 248812
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Name chloride channel, voltage-sensitive 1
Synonyms Clc1, SMCC1, NMF355, Clc-1, nmf355
MMRRC Submission 040369-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2403 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 42263619-42292690 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42290046 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 827 (I827T)
Ref Sequence ENSEMBL: ENSMUSP00000031894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031891] [ENSMUST00000031894] [ENSMUST00000095974] [ENSMUST00000143278] [ENSMUST00000164091] [ENSMUST00000168660]
AlphaFold Q64347
Predicted Effect probably benign
Transcript: ENSMUST00000031891
SMART Domains Protein: ENSMUSP00000031891
Gene: ENSMUSG00000029861

DomainStartEndE-ValueType
Pfam:FAM131 49 341 7.4e-128 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000031894
AA Change: I827T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: I827T

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095974
SMART Domains Protein: ENSMUSP00000093670
Gene: ENSMUSG00000029861

DomainStartEndE-ValueType
Pfam:FAM131 33 325 4.5e-128 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114684
SMART Domains Protein: ENSMUSP00000110332
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
Pfam:Voltage_CLC 3 254 2.6e-42 PFAM
CBS 294 344 1.3e1 SMART
low complexity region 405 429 N/A INTRINSIC
Blast:CBS 480 524 2e-13 BLAST
low complexity region 575 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143278
SMART Domains Protein: ENSMUSP00000116779
Gene: ENSMUSG00000029861

DomainStartEndE-ValueType
Pfam:FAM131 61 353 1.9e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163235
SMART Domains Protein: ENSMUSP00000132387
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163936
AA Change: I755T
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: I755T

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169902
Predicted Effect probably benign
Transcript: ENSMUST00000165780
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170028
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164091
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168660
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169024
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,964,592 (GRCm39) E925G probably damaging Het
Abca9 T G 11: 110,006,280 (GRCm39) Q1275P probably benign Het
Adgrl1 T A 8: 84,657,870 (GRCm39) M492K probably benign Het
Ankrd50 T A 3: 38,537,234 (GRCm39) K3* probably null Het
Arl5b T C 2: 15,079,848 (GRCm39) S140P probably damaging Het
Armc1 T C 3: 19,211,840 (GRCm39) probably benign Het
Ascc1 T C 10: 59,840,663 (GRCm39) I8T probably benign Het
Bche A G 3: 73,608,805 (GRCm39) V207A probably damaging Het
Cacna2d3 A G 14: 28,627,259 (GRCm39) L1080P probably benign Het
Ceacam3 C A 7: 16,895,779 (GRCm39) A583D probably damaging Het
Cep290 C T 10: 100,373,299 (GRCm39) A1193V probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Col28a1 T C 6: 8,175,641 (GRCm39) D69G possibly damaging Het
Cts3 A G 13: 61,712,806 (GRCm39) W305R probably damaging Het
Dmwd T C 7: 18,815,084 (GRCm39) I578T possibly damaging Het
Dnmt3a G A 12: 3,949,883 (GRCm39) V559M probably damaging Het
Dysf T C 6: 84,016,549 (GRCm39) V70A possibly damaging Het
Eml6 A G 11: 29,752,434 (GRCm39) V993A probably benign Het
Etl4 T A 2: 20,812,117 (GRCm39) L1768* probably null Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
Fat3 T G 9: 15,881,167 (GRCm39) D3235A probably damaging Het
Fbxo36 T A 1: 84,877,823 (GRCm39) F162I probably damaging Het
Fgfrl1 T C 5: 108,852,897 (GRCm39) W200R probably damaging Het
Fsip2 T C 2: 82,811,064 (GRCm39) M2461T possibly damaging Het
Fut1 A G 7: 45,268,643 (GRCm39) Y144C probably benign Het
Gprin3 G A 6: 59,331,134 (GRCm39) A391V probably benign Het
H2-Q4 A G 17: 35,598,973 (GRCm39) E81G probably damaging Het
Hacd3 A G 9: 64,908,311 (GRCm39) S162P probably damaging Het
Itga1 A T 13: 115,114,150 (GRCm39) H918Q probably benign Het
Lrp5 C A 19: 3,647,430 (GRCm39) D1271Y probably damaging Het
Lsm8 C T 6: 18,849,643 (GRCm39) T17I probably benign Het
Mup4 T A 4: 59,958,145 (GRCm39) D141V probably damaging Het
Nckap5 G A 1: 125,955,146 (GRCm39) H405Y probably benign Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or12k8 T C 2: 36,974,986 (GRCm39) Y258C probably benign Het
Ostf1 T C 19: 18,562,026 (GRCm39) K190R probably benign Het
Pnldc1 A T 17: 13,118,777 (GRCm39) V197E probably damaging Het
Ptprc A G 1: 138,016,270 (GRCm39) S531P probably damaging Het
Ryr3 C T 2: 112,516,973 (GRCm39) E3318K probably damaging Het
Scamp2 T C 9: 57,484,995 (GRCm39) V67A possibly damaging Het
Serpina3g C A 12: 104,207,421 (GRCm39) L195M probably damaging Het
Siglec1 G T 2: 130,916,395 (GRCm39) T1185N possibly damaging Het
Sycp2 G A 2: 178,045,528 (GRCm39) Q31* probably null Het
Tmprss15 T G 16: 78,854,578 (GRCm39) T277P probably damaging Het
Trim34b C T 7: 103,978,876 (GRCm39) S41L probably benign Het
Ttn T C 2: 76,557,705 (GRCm39) T21507A possibly damaging Het
Umad1 T C 6: 8,427,161 (GRCm39) V138A possibly damaging Het
Zfp523 A G 17: 28,414,183 (GRCm39) I72M probably damaging Het
Zfp655 C T 5: 145,181,356 (GRCm39) R405C probably benign Het
Zfp715 G A 7: 42,948,692 (GRCm39) R423C possibly damaging Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42,268,637 (GRCm39) missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42,287,606 (GRCm39) splice site probably benign
IGL02055:Clcn1 APN 6 42,284,489 (GRCm39) missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42,284,007 (GRCm39) splice site probably benign
IGL02649:Clcn1 APN 6 42,275,763 (GRCm39) missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42,263,714 (GRCm39) splice site probably null
IGL03148:Clcn1 APN 6 42,276,925 (GRCm39) critical splice donor site probably null
IGL03190:Clcn1 APN 6 42,267,037 (GRCm39) missense probably benign 0.02
IGL03327:Clcn1 APN 6 42,288,153 (GRCm39) missense probably benign 0.00
IGL03346:Clcn1 APN 6 42,288,153 (GRCm39) missense probably benign 0.00
Faint UTSW 6 42,284,199 (GRCm39) missense probably damaging 1.00
jack_spratt UTSW 6 42,287,515 (GRCm39) missense probably benign
Limitations UTSW 6 42,286,997 (GRCm39) missense possibly damaging 0.79
maimed UTSW 6 42,275,754 (GRCm39) missense probably damaging 1.00
stunted UTSW 6 42,263,701 (GRCm39) start codon destroyed possibly damaging 0.79
R0167:Clcn1 UTSW 6 42,263,770 (GRCm39) missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42,287,074 (GRCm39) missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42,287,515 (GRCm39) missense probably benign
R0573:Clcn1 UTSW 6 42,289,979 (GRCm39) splice site probably null
R0615:Clcn1 UTSW 6 42,282,509 (GRCm39) missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42,290,075 (GRCm39) missense probably benign 0.00
R1562:Clcn1 UTSW 6 42,277,169 (GRCm39) missense probably benign 0.29
R1566:Clcn1 UTSW 6 42,268,374 (GRCm39) missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42,290,032 (GRCm39) missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42,271,079 (GRCm39) missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42,275,860 (GRCm39) critical splice donor site probably null
R1861:Clcn1 UTSW 6 42,290,925 (GRCm39) missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42,282,475 (GRCm39) missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42,282,475 (GRCm39) missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42,268,559 (GRCm39) missense probably damaging 1.00
R2987:Clcn1 UTSW 6 42,275,784 (GRCm39) missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42,267,112 (GRCm39) missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42,269,929 (GRCm39) missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42,276,849 (GRCm39) missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42,276,849 (GRCm39) missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42,286,902 (GRCm39) missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42,267,131 (GRCm39) splice site probably null
R4836:Clcn1 UTSW 6 42,286,898 (GRCm39) missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42,287,922 (GRCm39) nonsense probably null
R5085:Clcn1 UTSW 6 42,290,814 (GRCm39) missense probably benign 0.41
R5528:Clcn1 UTSW 6 42,277,275 (GRCm39) missense probably benign 0.01
R5628:Clcn1 UTSW 6 42,275,823 (GRCm39) missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42,284,199 (GRCm39) missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42,269,900 (GRCm39) missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42,277,208 (GRCm39) nonsense probably null
R6175:Clcn1 UTSW 6 42,291,096 (GRCm39) missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42,290,172 (GRCm39) missense possibly damaging 0.82
R6394:Clcn1 UTSW 6 42,284,524 (GRCm39) missense possibly damaging 0.84
R7012:Clcn1 UTSW 6 42,267,542 (GRCm39) missense probably benign 0.01
R7020:Clcn1 UTSW 6 42,275,754 (GRCm39) missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42,284,477 (GRCm39) missense probably damaging 1.00
R7212:Clcn1 UTSW 6 42,268,323 (GRCm39) missense possibly damaging 0.46
R7225:Clcn1 UTSW 6 42,270,396 (GRCm39) missense probably damaging 1.00
R7264:Clcn1 UTSW 6 42,275,772 (GRCm39) missense probably damaging 1.00
R7636:Clcn1 UTSW 6 42,268,268 (GRCm39) nonsense probably null
R7663:Clcn1 UTSW 6 42,286,997 (GRCm39) missense possibly damaging 0.79
R7807:Clcn1 UTSW 6 42,287,282 (GRCm39) splice site probably null
R7954:Clcn1 UTSW 6 42,263,625 (GRCm39) unclassified probably benign
R8026:Clcn1 UTSW 6 42,284,595 (GRCm39) critical splice donor site probably null
R8045:Clcn1 UTSW 6 42,267,628 (GRCm39) missense probably damaging 1.00
R8499:Clcn1 UTSW 6 42,284,133 (GRCm39) missense probably damaging 1.00
R8523:Clcn1 UTSW 6 42,284,523 (GRCm39) nonsense probably null
R8677:Clcn1 UTSW 6 42,267,519 (GRCm39) critical splice acceptor site probably null
R8818:Clcn1 UTSW 6 42,282,477 (GRCm39) missense probably damaging 0.98
R8945:Clcn1 UTSW 6 42,263,701 (GRCm39) start codon destroyed possibly damaging 0.79
R9012:Clcn1 UTSW 6 42,268,567 (GRCm39) missense possibly damaging 0.75
R9295:Clcn1 UTSW 6 42,290,883 (GRCm39) missense probably benign 0.00
R9433:Clcn1 UTSW 6 42,282,494 (GRCm39) missense probably damaging 1.00
R9513:Clcn1 UTSW 6 42,282,462 (GRCm39) missense probably damaging 1.00
R9679:Clcn1 UTSW 6 42,263,753 (GRCm39) missense probably damaging 0.98
Z1088:Clcn1 UTSW 6 42,284,190 (GRCm39) missense probably damaging 1.00
Z1088:Clcn1 UTSW 6 42,277,294 (GRCm39) missense probably benign 0.40
Z1176:Clcn1 UTSW 6 42,284,501 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCTGTGGTCCTCTGAGAAG -3'
(R):5'- GGGGCCTATTCATCCTTACC -3'

Sequencing Primer
(F):5'- TCTGTGGTCCTCTGAGAAGAAAAAG -3'
(R):5'- TTCTAGTGCCAAGACACCTCTGAG -3'
Posted On 2014-11-11