Incidental Mutation 'R2403:Zfp715'
ID248817
Institutional Source Beutler Lab
Gene Symbol Zfp715
Ensembl Gene ENSMUSG00000012640
Gene Namezinc finger protein 715
Synonymsmszf15, 2610041B18Rik
MMRRC Submission 040369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2403 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43296197-43313294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43299268 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 423 (R423C)
Ref Sequence ENSEMBL: ENSMUSP00000103620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012796] [ENSMUST00000048015] [ENSMUST00000107986] [ENSMUST00000135130] [ENSMUST00000139061] [ENSMUST00000145622]
Predicted Effect probably benign
Transcript: ENSMUST00000012796
SMART Domains Protein: ENSMUSP00000012796
Gene: ENSMUSG00000012640

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 124 146 3.39e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000048015
AA Change: R423C

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040282
Gene: ENSMUSG00000012640
AA Change: R423C

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107986
AA Change: R423C

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103620
Gene: ENSMUSG00000012640
AA Change: R423C

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135130
SMART Domains Protein: ENSMUSP00000122812
Gene: ENSMUSG00000012640

DomainStartEndE-ValueType
KRAB 48 88 5.49e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139061
SMART Domains Protein: ENSMUSP00000114600
Gene: ENSMUSG00000012640

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151659
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,170,943 E925G probably damaging Het
Abca9 T G 11: 110,115,454 Q1275P probably benign Het
Adgrl1 T A 8: 83,931,241 M492K probably benign Het
Ankrd50 T A 3: 38,483,085 K3* probably null Het
Arl5b T C 2: 15,075,037 S140P probably damaging Het
Armc1 T C 3: 19,157,676 probably benign Het
Ascc1 T C 10: 60,004,841 I8T probably benign Het
Bche A G 3: 73,701,472 V207A probably damaging Het
Cacna2d3 A G 14: 28,905,302 L1080P probably benign Het
Ceacam3 C A 7: 17,161,854 A583D probably damaging Het
Cep290 C T 10: 100,537,437 A1193V probably benign Het
Clcn1 T C 6: 42,313,112 I827T probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col28a1 T C 6: 8,175,641 D69G possibly damaging Het
Cts3 A G 13: 61,564,992 W305R probably damaging Het
Dmwd T C 7: 19,081,159 I578T possibly damaging Het
Dnmt3a G A 12: 3,899,883 V559M probably damaging Het
Dysf T C 6: 84,039,567 V70A possibly damaging Het
Eml6 A G 11: 29,802,434 V993A probably benign Het
Etl4 T A 2: 20,807,306 L1768* probably null Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fat3 T G 9: 15,969,871 D3235A probably damaging Het
Fbxo36 T A 1: 84,900,102 F162I probably damaging Het
Fgfrl1 T C 5: 108,705,031 W200R probably damaging Het
Fsip2 T C 2: 82,980,720 M2461T possibly damaging Het
Fut1 A G 7: 45,619,219 Y144C probably benign Het
Gprin3 G A 6: 59,354,149 A391V probably benign Het
H2-Q4 A G 17: 35,379,997 E81G probably damaging Het
Hacd3 A G 9: 65,001,029 S162P probably damaging Het
Itga1 A T 13: 114,977,614 H918Q probably benign Het
Lrp5 C A 19: 3,597,430 D1271Y probably damaging Het
Lsm8 C T 6: 18,849,644 T17I probably benign Het
Mup4 T A 4: 59,958,145 D141V probably damaging Het
Nckap5 G A 1: 126,027,409 H405Y probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr361 T C 2: 37,084,974 Y258C probably benign Het
Ostf1 T C 19: 18,584,662 K190R probably benign Het
Pnldc1 A T 17: 12,899,890 V197E probably damaging Het
Ptprc A G 1: 138,088,532 S531P probably damaging Het
Ryr3 C T 2: 112,686,628 E3318K probably damaging Het
Scamp2 T C 9: 57,577,712 V67A possibly damaging Het
Serpina3g C A 12: 104,241,162 L195M probably damaging Het
Siglec1 G T 2: 131,074,475 T1185N possibly damaging Het
Sycp2 G A 2: 178,403,735 Q31* probably null Het
Tmprss15 T G 16: 79,057,690 T277P probably damaging Het
Trim34b C T 7: 104,329,669 S41L probably benign Het
Ttn T C 2: 76,727,361 T21507A possibly damaging Het
Umad1 T C 6: 8,427,161 V138A possibly damaging Het
Zfp523 A G 17: 28,195,209 I72M probably damaging Het
Zfp655 C T 5: 145,244,546 R405C probably benign Het
Other mutations in Zfp715
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Zfp715 APN 7 43299749 missense possibly damaging 0.53
IGL00984:Zfp715 APN 7 43299784 missense probably benign 0.28
IGL03401:Zfp715 APN 7 43299736 missense probably benign 0.18
R0373:Zfp715 UTSW 7 43299336 missense possibly damaging 0.96
R1167:Zfp715 UTSW 7 43298437 missense possibly damaging 0.83
R1943:Zfp715 UTSW 7 43299630 missense possibly damaging 0.86
R1987:Zfp715 UTSW 7 43298649 missense possibly damaging 0.71
R2073:Zfp715 UTSW 7 43311120 missense probably benign 0.01
R2116:Zfp715 UTSW 7 43297946 missense possibly damaging 0.71
R3707:Zfp715 UTSW 7 43311129 missense probably benign
R3838:Zfp715 UTSW 7 43299756 missense probably benign 0.33
R4059:Zfp715 UTSW 7 43301731 missense probably benign 0.11
R4110:Zfp715 UTSW 7 43297880 missense possibly damaging 0.72
R4426:Zfp715 UTSW 7 43311092 missense probably damaging 0.99
R4675:Zfp715 UTSW 7 43300020 missense probably benign 0.15
R4898:Zfp715 UTSW 7 43299682 missense possibly damaging 0.48
R5007:Zfp715 UTSW 7 43299595 missense possibly damaging 0.53
R5477:Zfp715 UTSW 7 43299954 missense probably damaging 0.99
R5574:Zfp715 UTSW 7 43311039 missense possibly damaging 0.94
R5594:Zfp715 UTSW 7 43299692 missense possibly damaging 0.73
R5967:Zfp715 UTSW 7 43299148 missense probably benign 0.04
R6538:Zfp715 UTSW 7 43299149 missense possibly damaging 0.73
R7322:Zfp715 UTSW 7 43311138 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGCTGTTTTACTGAATGACTTCCC -3'
(R):5'- CATCCATTCCAGCTGAAGGTG -3'

Sequencing Primer
(F):5'- GAATGACTTCCCACATTCACGG -3'
(R):5'- GTTCATACTGGAGGAGACCCTTAC -3'
Posted On2014-11-11