Incidental Mutation 'R0305:Vmn2r1'
ID24885
Institutional Source Beutler Lab
Gene Symbol Vmn2r1
Ensembl Gene ENSMUSG00000027824
Gene Namevomeronasal 2, receptor 1
SynonymsEG56544, V2r83
MMRRC Submission 038516-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0305 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64081642-64105458 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 64089666 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 248 (C248G)
Ref Sequence ENSEMBL: ENSMUSP00000029406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029406]
Predicted Effect probably damaging
Transcript: ENSMUST00000029406
AA Change: C248G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029406
Gene: ENSMUSG00000027824
AA Change: C248G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 86 504 6e-92 PFAM
Pfam:NCD3G 546 599 2.4e-17 PFAM
Pfam:7tm_3 632 866 4.1e-48 PFAM
Meta Mutation Damage Score 0.354 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,636 R183Q probably damaging Het
Abca5 A G 11: 110,273,311 probably benign Het
Ada T C 2: 163,728,157 K312R probably benign Het
Adam21 C A 12: 81,560,285 K234N possibly damaging Het
Afdn T A 17: 13,888,514 probably null Het
Aimp1 T G 3: 132,673,986 K132Q possibly damaging Het
Aldh16a1 C T 7: 45,147,979 R135Q probably damaging Het
Alox12b A T 11: 69,167,379 Y519F probably benign Het
Alppl2 T C 1: 87,089,602 E25G probably benign Het
Apob A T 12: 8,012,210 N3531I probably damaging Het
Arhgap23 T C 11: 97,501,109 L321P probably damaging Het
Cab39l C T 14: 59,519,579 Q137* probably null Het
Cenpo A T 12: 4,216,660 H149Q possibly damaging Het
Cpt1a A G 19: 3,378,455 T610A probably benign Het
Dcbld2 A G 16: 58,448,939 T271A probably damaging Het
Dcps A G 9: 35,175,769 probably null Het
Dnaic2 A G 11: 114,752,894 D462G probably benign Het
Dsg2 T A 18: 20,582,695 probably benign Het
Eomes A T 9: 118,484,757 E623D probably benign Het
Fam19a5 T A 15: 87,720,508 I83N probably damaging Het
Fras1 A T 5: 96,596,888 H594L probably benign Het
Gad1-ps T G 10: 99,444,803 noncoding transcript Het
Galk2 A G 2: 125,887,888 Y63C probably damaging Het
H2-T10 A G 17: 36,119,368 L227P probably damaging Het
Itgb4 T G 11: 115,979,412 C73G probably damaging Het
Itpr2 T C 6: 146,311,103 H1472R possibly damaging Het
Kcnh5 C T 12: 75,114,397 A246T probably benign Het
Kpna6 G T 4: 129,649,249 R458S probably benign Het
Lifr A G 15: 7,177,501 T498A probably damaging Het
Lrrd1 T G 5: 3,865,707 I768S probably damaging Het
Map2 T C 1: 66,413,094 V223A probably benign Het
Nod2 G A 8: 88,665,323 A731T probably damaging Het
Nrxn2 G A 19: 6,519,283 C1403Y probably damaging Het
Nxph1 A T 6: 9,247,754 I242F probably damaging Het
Olfr507 G A 7: 108,622,585 V258I probably benign Het
Pgr A G 9: 8,902,087 probably benign Het
Pik3cb A G 9: 99,064,076 S566P possibly damaging Het
Sema4d T C 13: 51,712,728 Y242C probably damaging Het
Sftpc T A 14: 70,524,078 probably benign Het
Sh3tc1 T G 5: 35,723,999 E33D probably benign Het
Slc17a5 A G 9: 78,557,537 L344P probably benign Het
Slc39a5 T A 10: 128,398,396 probably benign Het
Slc7a13 C A 4: 19,839,401 H335N probably benign Het
Slco1a4 A C 6: 141,817,753 N412K possibly damaging Het
Sox1 A T 8: 12,396,736 T126S probably damaging Het
Specc1l T A 10: 75,245,829 V353E probably damaging Het
Stat5b T C 11: 100,802,503 E104G probably benign Het
Sult4a1 A G 15: 84,086,667 V179A probably damaging Het
Tbl3 G A 17: 24,705,461 R134C probably damaging Het
Tmem256 T A 11: 69,838,911 probably benign Het
Tmigd1 A G 11: 76,907,134 T101A probably damaging Het
Unc5b C A 10: 60,779,658 probably benign Het
Unc79 T A 12: 103,113,200 S1679T probably benign Het
Vmn2r57 T C 7: 41,427,543 I400V probably benign Het
Vwa8 T A 14: 79,009,273 L685H probably damaging Het
Yeats4 A G 10: 117,215,836 F172S probably damaging Het
Zfpm2 T G 15: 40,774,035 probably benign Het
Other mutations in Vmn2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn2r1 APN 3 64104968 nonsense probably null
IGL00335:Vmn2r1 APN 3 64105388 missense probably damaging 0.96
IGL01509:Vmn2r1 APN 3 64103045 missense probably benign 0.03
IGL01641:Vmn2r1 APN 3 64104503 missense probably benign 0.19
IGL01656:Vmn2r1 APN 3 64081853 missense probably damaging 0.96
IGL01927:Vmn2r1 APN 3 64081684 missense probably benign 0.01
IGL02093:Vmn2r1 APN 3 64104709 missense probably benign
IGL02146:Vmn2r1 APN 3 64104683 missense probably benign 0.39
IGL02186:Vmn2r1 APN 3 64081717 missense probably benign 0.01
IGL02320:Vmn2r1 APN 3 64081759 missense possibly damaging 0.61
IGL02423:Vmn2r1 APN 3 64090244 missense probably benign 0.00
IGL02709:Vmn2r1 APN 3 64104934 missense probably benign 0.24
R0034:Vmn2r1 UTSW 3 64090014 missense probably damaging 1.00
R0064:Vmn2r1 UTSW 3 64104788 missense possibly damaging 0.76
R0152:Vmn2r1 UTSW 3 64081819 missense possibly damaging 0.92
R0314:Vmn2r1 UTSW 3 64086559 missense probably damaging 1.00
R0317:Vmn2r1 UTSW 3 64081819 missense possibly damaging 0.92
R0465:Vmn2r1 UTSW 3 64081759 missense possibly damaging 0.61
R1144:Vmn2r1 UTSW 3 64090120 missense probably damaging 1.00
R1163:Vmn2r1 UTSW 3 64086625 missense probably benign 0.03
R1448:Vmn2r1 UTSW 3 64101313 missense probably damaging 1.00
R1491:Vmn2r1 UTSW 3 64089613 missense probably damaging 1.00
R1543:Vmn2r1 UTSW 3 64089573 missense probably damaging 1.00
R1611:Vmn2r1 UTSW 3 64104537 nonsense probably null
R1676:Vmn2r1 UTSW 3 64090182 nonsense probably null
R1727:Vmn2r1 UTSW 3 64081742 missense probably benign
R1851:Vmn2r1 UTSW 3 64101505 missense probably benign 0.32
R3080:Vmn2r1 UTSW 3 64089784 missense probably damaging 1.00
R3790:Vmn2r1 UTSW 3 64086764 critical splice donor site probably null
R4111:Vmn2r1 UTSW 3 64089755 missense probably benign 0.23
R4689:Vmn2r1 UTSW 3 64104653 missense possibly damaging 0.94
R4747:Vmn2r1 UTSW 3 64081846 missense probably benign 0.00
R4970:Vmn2r1 UTSW 3 64090123 missense possibly damaging 0.81
R5033:Vmn2r1 UTSW 3 64105080 missense probably damaging 1.00
R5086:Vmn2r1 UTSW 3 64089997 missense probably benign 0.00
R5112:Vmn2r1 UTSW 3 64090123 missense possibly damaging 0.81
R5385:Vmn2r1 UTSW 3 64101398 missense possibly damaging 0.89
R5629:Vmn2r1 UTSW 3 64105117 missense possibly damaging 0.87
R5762:Vmn2r1 UTSW 3 64090053 missense probably benign 0.24
R5867:Vmn2r1 UTSW 3 64104569 missense probably benign
R5893:Vmn2r1 UTSW 3 64086553 missense probably damaging 1.00
R6037:Vmn2r1 UTSW 3 64081729 missense probably benign 0.00
R6037:Vmn2r1 UTSW 3 64081729 missense probably benign 0.00
R6290:Vmn2r1 UTSW 3 64105452 missense probably benign 0.02
R6443:Vmn2r1 UTSW 3 64104953 missense possibly damaging 0.78
R6464:Vmn2r1 UTSW 3 64101345 missense probably benign
R6826:Vmn2r1 UTSW 3 64105146 nonsense probably null
R6874:Vmn2r1 UTSW 3 64104955 missense probably damaging 1.00
R6882:Vmn2r1 UTSW 3 64090108 missense possibly damaging 0.64
R6983:Vmn2r1 UTSW 3 64081697 missense probably benign
R7010:Vmn2r1 UTSW 3 64104725 missense probably benign 0.19
R7144:Vmn2r1 UTSW 3 64089941 missense probably damaging 1.00
R7341:Vmn2r1 UTSW 3 64105456 makesense probably null
R7510:Vmn2r1 UTSW 3 64086501 missense not run
R7557:Vmn2r1 UTSW 3 64090054 missense not run
X0065:Vmn2r1 UTSW 3 64090257 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCATCAATTGTTGGCTGCCCTAACC -3'
(R):5'- AGAGCAGAGGTAATCCAGGCTTCG -3'

Sequencing Primer
(F):5'- GGAAACAGAACTATTTGGCTCC -3'
(R):5'- TAATCCAGGCTTCGGTGGC -3'
Posted On2013-04-16