Incidental Mutation 'R0305:Aimp1'
ID24887
Institutional Source Beutler Lab
Gene Symbol Aimp1
Ensembl Gene ENSMUSG00000028029
Gene Nameaminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Synonyms9830137A06Rik, AIMP1/p43, Scye1, Emap2, EMAPII
MMRRC Submission 038516-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.622) question?
Stock #R0305 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location132660499-132684370 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 132673986 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 132 (K132Q)
Ref Sequence ENSEMBL: ENSMUSP00000029663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029663] [ENSMUST00000196206] [ENSMUST00000196963] [ENSMUST00000197793] [ENSMUST00000198513]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029663
AA Change: K132Q

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029663
Gene: ENSMUSG00000028029
AA Change: K132Q

DomainStartEndE-ValueType
coiled coil region 17 84 N/A INTRINSIC
low complexity region 124 144 N/A INTRINSIC
Pfam:tRNA_bind 164 257 2.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196206
SMART Domains Protein: ENSMUSP00000142914
Gene: ENSMUSG00000028029

DomainStartEndE-ValueType
coiled coil region 8 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197646
Predicted Effect probably benign
Transcript: ENSMUST00000197793
SMART Domains Protein: ENSMUSP00000142534
Gene: ENSMUSG00000028029

DomainStartEndE-ValueType
coiled coil region 8 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198513
SMART Domains Protein: ENSMUSP00000142513
Gene: ENSMUSG00000028029

DomainStartEndE-ValueType
coiled coil region 8 75 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200025
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that is specifically induced by apoptosis, and it is involved in the control of angiogenesis, inflammation, and wound healing. The release of this cytokine renders the tumor-associated vasculature sensitive to tumor necrosis factor. The precursor protein is identical to the p43 subunit, which is associated with the multi-tRNA synthetase complex, and it modulates aminoacylation activity of tRNA synthetase in normal cells. This protein is also involved in the stimulation of inflammatory responses after proteolytic cleavage in tumor cells. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display delayed wound healing and decreased inflammatory response after wounding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,636 R183Q probably damaging Het
Abca5 A G 11: 110,273,311 probably benign Het
Ada T C 2: 163,728,157 K312R probably benign Het
Adam21 C A 12: 81,560,285 K234N possibly damaging Het
Afdn T A 17: 13,888,514 probably null Het
Aldh16a1 C T 7: 45,147,979 R135Q probably damaging Het
Alox12b A T 11: 69,167,379 Y519F probably benign Het
Alppl2 T C 1: 87,089,602 E25G probably benign Het
Apob A T 12: 8,012,210 N3531I probably damaging Het
Arhgap23 T C 11: 97,501,109 L321P probably damaging Het
Cab39l C T 14: 59,519,579 Q137* probably null Het
Cenpo A T 12: 4,216,660 H149Q possibly damaging Het
Cpt1a A G 19: 3,378,455 T610A probably benign Het
Dcbld2 A G 16: 58,448,939 T271A probably damaging Het
Dcps A G 9: 35,175,769 probably null Het
Dnaic2 A G 11: 114,752,894 D462G probably benign Het
Dsg2 T A 18: 20,582,695 probably benign Het
Eomes A T 9: 118,484,757 E623D probably benign Het
Fam19a5 T A 15: 87,720,508 I83N probably damaging Het
Fras1 A T 5: 96,596,888 H594L probably benign Het
Gad1-ps T G 10: 99,444,803 noncoding transcript Het
Galk2 A G 2: 125,887,888 Y63C probably damaging Het
H2-T10 A G 17: 36,119,368 L227P probably damaging Het
Itgb4 T G 11: 115,979,412 C73G probably damaging Het
Itpr2 T C 6: 146,311,103 H1472R possibly damaging Het
Kcnh5 C T 12: 75,114,397 A246T probably benign Het
Kpna6 G T 4: 129,649,249 R458S probably benign Het
Lifr A G 15: 7,177,501 T498A probably damaging Het
Lrrd1 T G 5: 3,865,707 I768S probably damaging Het
Map2 T C 1: 66,413,094 V223A probably benign Het
Nod2 G A 8: 88,665,323 A731T probably damaging Het
Nrxn2 G A 19: 6,519,283 C1403Y probably damaging Het
Nxph1 A T 6: 9,247,754 I242F probably damaging Het
Olfr507 G A 7: 108,622,585 V258I probably benign Het
Pgr A G 9: 8,902,087 probably benign Het
Pik3cb A G 9: 99,064,076 S566P possibly damaging Het
Sema4d T C 13: 51,712,728 Y242C probably damaging Het
Sftpc T A 14: 70,524,078 probably benign Het
Sh3tc1 T G 5: 35,723,999 E33D probably benign Het
Slc17a5 A G 9: 78,557,537 L344P probably benign Het
Slc39a5 T A 10: 128,398,396 probably benign Het
Slc7a13 C A 4: 19,839,401 H335N probably benign Het
Slco1a4 A C 6: 141,817,753 N412K possibly damaging Het
Sox1 A T 8: 12,396,736 T126S probably damaging Het
Specc1l T A 10: 75,245,829 V353E probably damaging Het
Stat5b T C 11: 100,802,503 E104G probably benign Het
Sult4a1 A G 15: 84,086,667 V179A probably damaging Het
Tbl3 G A 17: 24,705,461 R134C probably damaging Het
Tmem256 T A 11: 69,838,911 probably benign Het
Tmigd1 A G 11: 76,907,134 T101A probably damaging Het
Unc5b C A 10: 60,779,658 probably benign Het
Unc79 T A 12: 103,113,200 S1679T probably benign Het
Vmn2r1 T G 3: 64,089,666 C248G probably damaging Het
Vmn2r57 T C 7: 41,427,543 I400V probably benign Het
Vwa8 T A 14: 79,009,273 L685H probably damaging Het
Yeats4 A G 10: 117,215,836 F172S probably damaging Het
Zfpm2 T G 15: 40,774,035 probably benign Het
Other mutations in Aimp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Aimp1 APN 3 132677143 splice site probably benign
IGL00742:Aimp1 APN 3 132671981 nonsense probably null
IGL01863:Aimp1 APN 3 132672092 missense probably benign 0.03
IGL02432:Aimp1 APN 3 132673977 missense probably benign
R0699:Aimp1 UTSW 3 132674865 splice site probably benign
R1734:Aimp1 UTSW 3 132674796 missense probably damaging 1.00
R1793:Aimp1 UTSW 3 132674064 missense probably benign 0.21
R1975:Aimp1 UTSW 3 132677099 missense possibly damaging 0.81
R2010:Aimp1 UTSW 3 132667492 missense probably benign 0.01
R4424:Aimp1 UTSW 3 132667492 missense probably benign 0.01
R4583:Aimp1 UTSW 3 132677047 missense probably damaging 0.99
R6135:Aimp1 UTSW 3 132672083 missense probably benign 0.30
R6285:Aimp1 UTSW 3 132667504 missense possibly damaging 0.81
R7270:Aimp1 UTSW 3 132677011 missense probably damaging 1.00
X0057:Aimp1 UTSW 3 132677112 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGTGACTTCTTTGGAATGGAGC -3'
(R):5'- TTTCTGTGACTCAGTGGAGCAAGTG -3'

Sequencing Primer
(F):5'- gcgtaagataactcacttcacc -3'
(R):5'- GTCTCCATCAGTAGCAACCA -3'
Posted On2013-04-16