Mutagenetix > Incidental Mutation

Incidental Mutation 'R2415:Sec24b'

248959

Institutional Source

Beutler Lab

Gene Symbol

Sec24b

Ensembl Gene

ENSMUSG00000001052

Gene Name

SEC24 homolog B, COPII coat complex component

Synonyms

SEC24

MMRRC Submission

040379-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.799) question?

Stock #

R2415 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129776408-129855202 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 129789729 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 764 (I764N)

Ref Sequence

ENSEMBL: ENSMUSP00000001079 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001079] [ENSMUST00000165873]

AlphaFold

Q80ZX0

Predicted Effect

probably benign
Transcript: ENSMUST00000001079
AA Change: I764N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000001079
Gene: ENSMUSG00000001052
AA Change: I764N

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
low complexity region	127	143	N/A	INTRINSIC
low complexity region	229	254	N/A	INTRINSIC
low complexity region	316	333	N/A	INTRINSIC
low complexity region	351	362	N/A	INTRINSIC
low complexity region	363	373	N/A	INTRINSIC
low complexity region	378	386	N/A	INTRINSIC
low complexity region	419	444	N/A	INTRINSIC
low complexity region	450	473	N/A	INTRINSIC
low complexity region	486	505	N/A	INTRINSIC
low complexity region	555	568	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	585	622	4.1e-17	PFAM
Pfam:Sec23_trunk	658	897	2.4e-87	PFAM
Pfam:Sec23_BS	902	986	3.4e-23	PFAM
Pfam:Sec23_helical	999	1099	8.7e-31	PFAM
Pfam:Gelsolin	1122	1197	4.9e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165873
AA Change: I501N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000132861
Gene: ENSMUSG00000001052
AA Change: I501N

Domain	Start	End	E-Value	Type
low complexity region	1	26	N/A	INTRINSIC
low complexity region	88	105	N/A	INTRINSIC
low complexity region	115	123	N/A	INTRINSIC
low complexity region	156	181	N/A	INTRINSIC
low complexity region	187	210	N/A	INTRINSIC
low complexity region	223	242	N/A	INTRINSIC
low complexity region	292	305	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	321	359	2.5e-18	PFAM
Pfam:Sec23_trunk	395	634	1.6e-87	PFAM
Pfam:Sec23_BS	639	723	2.2e-23	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein is thought to be a cargo-binding component of the COPII vesicle, and is thought to be involved in the transport of secretory proteins from the endoplasmic reticulum to the Golgi apparatus. Mutations in this gene have been associated with neural tube defects, and are thought to be a result of a disruption in interactions with the protein encoded by the VANGL planar cell polarity protein 2 (VANGL2) gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit craniorachischisis, abnormal embryo shape, omphalocele, disoriented hair cells, and failure of eyelid fusion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano6	A	T	15: 95,860,161 (GRCm39)	N761I	probably damaging	Het
Atad5	T	C	11: 79,985,077 (GRCm39)	S55P	probably damaging	Het
Cul9	T	A	17: 46,854,364 (GRCm39)	T113S	probably benign	Het
Ddx56	G	A	11: 6,211,727 (GRCm39)		probably benign	Het
Dnttip2	T	C	3: 122,070,186 (GRCm39)	V467A	probably damaging	Het
Efhb	A	T	17: 53,770,124 (GRCm39)	F62I	probably benign	Het
Efl1	T	A	7: 82,347,175 (GRCm39)	M567K	probably damaging	Het
Fbxw21	G	T	9: 108,985,469 (GRCm39)	A103E	possibly damaging	Het
Flnb	T	A	14: 7,929,932 (GRCm38)	S2021T	probably benign	Het
Gabpa	T	C	16: 84,641,256 (GRCm39)		probably null	Het
Grid1	A	T	14: 35,172,326 (GRCm39)	I611F	possibly damaging	Het
Hdac1	A	C	4: 129,416,754 (GRCm39)		probably null	Het
Kcnk5	T	C	14: 20,191,880 (GRCm39)	E427G	possibly damaging	Het
Kcnu1	A	T	8: 26,400,906 (GRCm39)	T685S	probably benign	Het
Khdc1b	A	G	1: 21,454,534 (GRCm39)	D79G	probably benign	Het
Ky	G	T	9: 102,419,090 (GRCm39)	G366W	probably damaging	Het
Limch1	T	C	5: 67,131,977 (GRCm39)	S147P	probably damaging	Het
Mroh1	A	G	15: 76,305,411 (GRCm39)	K405E	probably damaging	Het
Myo15b	T	G	11: 115,770,390 (GRCm39)	F67V	probably benign	Het
Nlrp4c	A	G	7: 6,069,047 (GRCm39)	D316G	probably damaging	Het
Nudt12	A	G	17: 59,313,603 (GRCm39)	V325A	probably damaging	Het
Pdia4	G	T	6: 47,783,490 (GRCm39)	D184E	probably benign	Het
Per3	A	C	4: 151,097,147 (GRCm39)	F793V	possibly damaging	Het
Pla1a	T	A	16: 38,228,112 (GRCm39)	Y255F	possibly damaging	Het
Rxfp1	A	G	3: 79,570,626 (GRCm39)	S269P	probably benign	Het
S100pbp	A	T	4: 129,075,614 (GRCm39)	V118D	possibly damaging	Het
Sh3bp1	C	T	15: 78,785,361 (GRCm39)		probably benign	Het
Surf6	C	T	2: 26,782,274 (GRCm39)	R351H	probably damaging	Het
Tspan15	A	G	10: 62,037,570 (GRCm39)	I115T	probably benign	Het
Vmn2r73	T	C	7: 85,521,431 (GRCm39)	Y179C	probably damaging	Het
Zfp750	T	C	11: 121,403,305 (GRCm39)	D481G	probably benign	Het

Other mutations in Sec24b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00984:Sec24b	APN	3	129,814,295 (GRCm39)	intron	probably benign
IGL01137:Sec24b	APN	3	129,801,093 (GRCm39)	missense	probably benign	0.02
IGL01370:Sec24b	APN	3	129,801,253 (GRCm39)	splice site	probably benign
IGL01931:Sec24b	APN	3	129,803,448 (GRCm39)	missense	probably benign	0.00
PIT4696001:Sec24b	UTSW	3	129,788,040 (GRCm39)	missense	probably benign	0.01
R0193:Sec24b	UTSW	3	129,782,633 (GRCm39)	missense	probably null
R0194:Sec24b	UTSW	3	129,777,814 (GRCm39)	critical splice donor site	probably null
R0403:Sec24b	UTSW	3	129,793,183 (GRCm39)	missense	probably damaging	1.00
R0403:Sec24b	UTSW	3	129,783,325 (GRCm39)	missense	possibly damaging	0.81
R0576:Sec24b	UTSW	3	129,834,985 (GRCm39)	missense	probably benign	0.11
R0583:Sec24b	UTSW	3	129,834,960 (GRCm39)	nonsense	probably null
R0963:Sec24b	UTSW	3	129,834,554 (GRCm39)	missense	probably benign	0.02
R0967:Sec24b	UTSW	3	129,790,431 (GRCm39)	missense	probably damaging	1.00
R1344:Sec24b	UTSW	3	129,801,072 (GRCm39)	missense	probably damaging	1.00
R1418:Sec24b	UTSW	3	129,801,072 (GRCm39)	missense	probably damaging	1.00
R1594:Sec24b	UTSW	3	129,785,000 (GRCm39)	missense	probably benign	0.00
R1716:Sec24b	UTSW	3	129,834,665 (GRCm39)	missense	possibly damaging	0.89
R1938:Sec24b	UTSW	3	129,785,010 (GRCm39)	missense	possibly damaging	0.82
R2020:Sec24b	UTSW	3	129,781,377 (GRCm39)	missense	probably damaging	1.00
R2407:Sec24b	UTSW	3	129,795,965 (GRCm39)	missense	probably benign	0.02
R3121:Sec24b	UTSW	3	129,795,953 (GRCm39)	critical splice donor site	probably null
R3729:Sec24b	UTSW	3	129,827,482 (GRCm39)	missense	possibly damaging	0.95
R3731:Sec24b	UTSW	3	129,827,482 (GRCm39)	missense	possibly damaging	0.95
R3789:Sec24b	UTSW	3	129,814,276 (GRCm39)	missense	probably benign	0.00
R4229:Sec24b	UTSW	3	129,834,368 (GRCm39)	missense	probably benign	0.24
R4230:Sec24b	UTSW	3	129,834,368 (GRCm39)	missense	probably benign	0.24
R4617:Sec24b	UTSW	3	129,834,413 (GRCm39)	missense	possibly damaging	0.94
R4856:Sec24b	UTSW	3	129,777,619 (GRCm39)	missense	probably benign	0.07
R4886:Sec24b	UTSW	3	129,777,619 (GRCm39)	missense	probably benign	0.07
R4913:Sec24b	UTSW	3	129,796,028 (GRCm39)	missense	probably benign	0.07
R5510:Sec24b	UTSW	3	129,834,544 (GRCm39)	missense	probably damaging	1.00
R5601:Sec24b	UTSW	3	129,834,483 (GRCm39)	small insertion	probably benign
R6167:Sec24b	UTSW	3	129,782,550 (GRCm39)	missense	possibly damaging	0.88
R6314:Sec24b	UTSW	3	129,800,894 (GRCm39)	splice site	probably null
R6442:Sec24b	UTSW	3	129,790,350 (GRCm39)	missense	probably damaging	1.00
R6512:Sec24b	UTSW	3	129,834,946 (GRCm39)	missense	probably damaging	1.00
R6743:Sec24b	UTSW	3	129,834,881 (GRCm39)	missense	probably damaging	0.98
R7081:Sec24b	UTSW	3	129,781,391 (GRCm39)	missense	probably benign	0.00
R7179:Sec24b	UTSW	3	129,782,595 (GRCm39)	missense	probably damaging	1.00
R7214:Sec24b	UTSW	3	129,827,509 (GRCm39)	missense	probably benign	0.19
R7332:Sec24b	UTSW	3	129,835,042 (GRCm39)	missense	probably benign	0.10
R7414:Sec24b	UTSW	3	129,803,514 (GRCm39)	missense	probably benign	0.01
R7599:Sec24b	UTSW	3	129,834,460 (GRCm39)	small insertion	probably benign
R7774:Sec24b	UTSW	3	129,777,846 (GRCm39)	missense	possibly damaging	0.88
R7895:Sec24b	UTSW	3	129,789,598 (GRCm39)	missense	probably benign	0.13
R8146:Sec24b	UTSW	3	129,789,573 (GRCm39)	nonsense	probably null
R8217:Sec24b	UTSW	3	129,834,599 (GRCm39)	missense	possibly damaging	0.94
R8344:Sec24b	UTSW	3	129,798,650 (GRCm39)	missense	probably damaging	0.97
R8525:Sec24b	UTSW	3	129,805,467 (GRCm39)	missense	probably damaging	1.00
R8699:Sec24b	UTSW	3	129,798,653 (GRCm39)	missense	probably damaging	1.00
R8783:Sec24b	UTSW	3	129,783,342 (GRCm39)	missense	probably benign
R8929:Sec24b	UTSW	3	129,803,507 (GRCm39)	missense	possibly damaging	0.80
R8967:Sec24b	UTSW	3	129,785,084 (GRCm39)	missense	probably damaging	1.00
R9332:Sec24b	UTSW	3	129,801,220 (GRCm39)	missense	probably benign	0.01
R9355:Sec24b	UTSW	3	129,787,489 (GRCm39)	missense	possibly damaging	0.60
R9660:Sec24b	UTSW	3	129,790,422 (GRCm39)	missense	probably damaging	1.00
R9728:Sec24b	UTSW	3	129,790,422 (GRCm39)	missense	probably damaging	1.00
R9781:Sec24b	UTSW	3	129,789,742 (GRCm39)	missense	probably damaging	0.98
X0065:Sec24b	UTSW	3	129,790,004 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AACGCCCGTGGTTATGATCC -3'
(R):5'- GCAGTAAGCTTGGTTTCCTG -3'

Sequencing Primer
(F):5'- CGTGGTTATGATCCAAACACTCG -3'
(R):5'- TGCAGTGCGTGAGACAC -3'

Posted On

2014-11-12