Mutagenetix > Incidental Mutation

Incidental Mutation 'R2415:S100pbp'

248960

Institutional Source

Beutler Lab

Gene Symbol

S100pbp

Ensembl Gene

ENSMUSG00000040928

Gene Name

S100P binding protein

Synonyms

4930429A08Rik

MMRRC Submission

040379-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.177) question?

Stock #

R2415 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129041795-129083485 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 129075614 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 118 (V118D)

Ref Sequence

ENSEMBL: ENSMUSP00000101674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049081] [ENSMUST00000072431] [ENSMUST00000106059] [ENSMUST00000106061] [ENSMUST00000117350] [ENSMUST00000117497] [ENSMUST00000117965]

AlphaFold

Q9D5K4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049081
AA Change: V237D

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000039820
Gene: ENSMUSG00000040928
AA Change: V237D

Domain	Start	End	E-Value	Type
Pfam:S100PBPR	21	382	4.4e-194	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072431
AA Change: V159D

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000072258
Gene: ENSMUSG00000040928
AA Change: V159D

Domain	Start	End	E-Value	Type
Pfam:S100PBPR	21	108	1.6e-36	PFAM
Pfam:S100PBPR	107	162	2.1e-17	PFAM
Pfam:S100PBPR	153	304	6.6e-87	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106059
AA Change: V118D

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000101674
Gene: ENSMUSG00000040928
AA Change: V118D

Domain	Start	End	E-Value	Type
Pfam:S100PBPR	21	67	1.2e-23	PFAM
Pfam:S100PBPR	66	121	1.1e-17	PFAM
Pfam:S100PBPR	112	263	4.9e-87	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106061
AA Change: V237D

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000101676
Gene: ENSMUSG00000040928
AA Change: V237D

Domain	Start	End	E-Value	Type
Pfam:S100PBPR	21	382	8.5e-193	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117350
AA Change: V237D

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000113214
Gene: ENSMUSG00000040928
AA Change: V237D

Domain	Start	End	E-Value	Type
Pfam:S100PBPR	21	337	1.4e-147	PFAM
low complexity region	353	366	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117497
AA Change: V195D

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000113084
Gene: ENSMUSG00000040928
AA Change: V195D

Domain	Start	End	E-Value	Type
Pfam:S100PBPR	21	198	2.4e-83	PFAM
Pfam:S100PBPR	189	327	1.1e-77	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117965
AA Change: V195D

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000113920
Gene: ENSMUSG00000040928
AA Change: V195D

Domain	Start	End	E-Value	Type
Pfam:S100PBPR	21	198	2.4e-83	PFAM
Pfam:S100PBPR	189	327	1.1e-77	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142490

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126748

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137992

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151971

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148920

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148112

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122942

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was originally identified by its interaction with S100 calcium-binding protein P. Expression of this protein has been reported to be associated with pancreatic ductal adenocarcinoma. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano6	A	T	15: 95,860,161 (GRCm39)	N761I	probably damaging	Het
Atad5	T	C	11: 79,985,077 (GRCm39)	S55P	probably damaging	Het
Cul9	T	A	17: 46,854,364 (GRCm39)	T113S	probably benign	Het
Ddx56	G	A	11: 6,211,727 (GRCm39)		probably benign	Het
Dnttip2	T	C	3: 122,070,186 (GRCm39)	V467A	probably damaging	Het
Efhb	A	T	17: 53,770,124 (GRCm39)	F62I	probably benign	Het
Efl1	T	A	7: 82,347,175 (GRCm39)	M567K	probably damaging	Het
Fbxw21	G	T	9: 108,985,469 (GRCm39)	A103E	possibly damaging	Het
Flnb	T	A	14: 7,929,932 (GRCm38)	S2021T	probably benign	Het
Gabpa	T	C	16: 84,641,256 (GRCm39)		probably null	Het
Grid1	A	T	14: 35,172,326 (GRCm39)	I611F	possibly damaging	Het
Hdac1	A	C	4: 129,416,754 (GRCm39)		probably null	Het
Kcnk5	T	C	14: 20,191,880 (GRCm39)	E427G	possibly damaging	Het
Kcnu1	A	T	8: 26,400,906 (GRCm39)	T685S	probably benign	Het
Khdc1b	A	G	1: 21,454,534 (GRCm39)	D79G	probably benign	Het
Ky	G	T	9: 102,419,090 (GRCm39)	G366W	probably damaging	Het
Limch1	T	C	5: 67,131,977 (GRCm39)	S147P	probably damaging	Het
Mroh1	A	G	15: 76,305,411 (GRCm39)	K405E	probably damaging	Het
Myo15b	T	G	11: 115,770,390 (GRCm39)	F67V	probably benign	Het
Nlrp4c	A	G	7: 6,069,047 (GRCm39)	D316G	probably damaging	Het
Nudt12	A	G	17: 59,313,603 (GRCm39)	V325A	probably damaging	Het
Pdia4	G	T	6: 47,783,490 (GRCm39)	D184E	probably benign	Het
Per3	A	C	4: 151,097,147 (GRCm39)	F793V	possibly damaging	Het
Pla1a	T	A	16: 38,228,112 (GRCm39)	Y255F	possibly damaging	Het
Rxfp1	A	G	3: 79,570,626 (GRCm39)	S269P	probably benign	Het
Sec24b	A	T	3: 129,789,729 (GRCm39)	I764N	probably benign	Het
Sh3bp1	C	T	15: 78,785,361 (GRCm39)		probably benign	Het
Surf6	C	T	2: 26,782,274 (GRCm39)	R351H	probably damaging	Het
Tspan15	A	G	10: 62,037,570 (GRCm39)	I115T	probably benign	Het
Vmn2r73	T	C	7: 85,521,431 (GRCm39)	Y179C	probably damaging	Het
Zfp750	T	C	11: 121,403,305 (GRCm39)	D481G	probably benign	Het

Other mutations in S100pbp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00836:S100pbp	APN	4	129,075,901 (GRCm39)	missense	possibly damaging	0.94
IGL02302:S100pbp	APN	4	129,076,234 (GRCm39)	missense	probably damaging	1.00
IGL02554:S100pbp	APN	4	129,075,644 (GRCm39)	splice site	probably null
R0068:S100pbp	UTSW	4	129,038,249 (GRCm39)	unclassified	probably benign
R1720:S100pbp	UTSW	4	129,075,886 (GRCm39)	missense	probably damaging	1.00
R2058:S100pbp	UTSW	4	129,075,893 (GRCm39)	missense	probably benign	0.02
R2762:S100pbp	UTSW	4	129,049,219 (GRCm39)	nonsense	probably null
R4815:S100pbp	UTSW	4	129,044,726 (GRCm39)	unclassified	probably benign
R5537:S100pbp	UTSW	4	129,075,981 (GRCm39)	missense	probably benign	0.39
R7113:S100pbp	UTSW	4	129,075,896 (GRCm39)	missense	probably damaging	0.96
R7384:S100pbp	UTSW	4	129,075,702 (GRCm39)	missense	probably benign	0.02
R7453:S100pbp	UTSW	4	129,075,878 (GRCm39)	missense	probably damaging	1.00
R8839:S100pbp	UTSW	4	129,076,000 (GRCm39)	critical splice donor site	probably null
R8979:S100pbp	UTSW	4	129,076,133 (GRCm39)	missense	probably damaging	0.97
R9109:S100pbp	UTSW	4	129,044,847 (GRCm39)	missense	probably damaging	1.00
R9298:S100pbp	UTSW	4	129,044,847 (GRCm39)	missense	probably damaging	1.00
R9686:S100pbp	UTSW	4	129,049,271 (GRCm39)	missense	probably damaging	0.96
Z1176:S100pbp	UTSW	4	129,044,750 (GRCm39)	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- TGGAATATATGATGGCCACAGG -3'
(R):5'- AACGTTGCACTGAGCCTGAAG -3'

Sequencing Primer
(F):5'- CATTACAGATGGTTGTAAGCCGCC -3'
(R):5'- CAATACCTCTGCTTGGGAT -3'

Posted On

2014-11-12