Incidental Mutation 'R2417:Cfap65'
ID 249020
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R2417 (G1)
Quality Score 217
Status Not validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) GTCTT to GTCTTCTT at 74966345 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139950
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T A 17: 41,191,101 (GRCm39) K109N probably benign Het
Adcy3 T C 12: 4,258,627 (GRCm39) V848A probably benign Het
Ahnak2 G A 12: 112,741,805 (GRCm39) P756S probably damaging Het
Alpk3 C A 7: 80,742,501 (GRCm39) P773T probably benign Het
Arhgef38 T C 3: 132,852,234 (GRCm39) K319E probably damaging Het
Bbs7 C T 3: 36,646,546 (GRCm39) A425T probably damaging Het
Cacna1e T A 1: 154,347,939 (GRCm39) R879W probably damaging Het
Cpsf7 T C 19: 10,503,332 (GRCm39) probably benign Het
Ctf2 A G 7: 127,318,759 (GRCm39) V80A probably benign Het
Ddhd1 A G 14: 45,894,729 (GRCm39) L30P probably damaging Het
Eml1 A G 12: 108,502,534 (GRCm39) D700G probably benign Het
Epha7 C T 4: 28,947,579 (GRCm39) P613L probably damaging Het
Fam43b G C 4: 138,122,409 (GRCm39) R304G probably benign Het
Itih3 G A 14: 30,639,621 (GRCm39) T400I probably benign Het
Lrrc14 T A 15: 76,597,621 (GRCm39) L117Q probably damaging Het
Ncbp1 C T 4: 46,168,530 (GRCm39) S626L probably benign Het
Nefh C T 11: 4,889,479 (GRCm39) D1047N unknown Het
Ptprm T G 17: 67,251,321 (GRCm39) T519P probably damaging Het
Sorl1 T G 9: 41,892,007 (GRCm39) D1881A probably damaging Het
Sox12 T C 2: 152,238,717 (GRCm39) D301G possibly damaging Het
Vmn2r14 C T 5: 109,372,329 (GRCm39) E54K probably benign Het
Vmn2r26 A G 6: 124,038,309 (GRCm39) N628S probably damaging Het
Zfp143 G A 7: 109,668,803 (GRCm39) V36M possibly damaging Het
Zfp850 A T 7: 27,688,608 (GRCm39) N533K possibly damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACGACCATTACCTCTACAG -3'
(R):5'- AGTAAAAGATGTCCGCCCCG -3'

Sequencing Primer
(F):5'- GGACGACCATTACCTCTACAGAAACC -3'
(R):5'- CTCTGGGCAGCCTTGAGATG -3'
Posted On 2014-11-12