Incidental Mutation 'R2417:Adcy3'
ID249040
Institutional Source Beutler Lab
Gene Symbol Adcy3
Ensembl Gene ENSMUSG00000020654
Gene Nameadenylate cyclase 3
SynonymsAC3
Accession Numbers

Ncbi RefSeq: NM_138305.3, NM_001159536.1, NM_001159537.1; MGI:99675

Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R2417 (G1)
Quality Score129
Status Not validated
Chromosome12
Chromosomal Location4133103-4213525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4208627 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 848 (V848A)
Ref Sequence ENSEMBL: ENSMUSP00000115644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020981] [ENSMUST00000020984] [ENSMUST00000111169] [ENSMUST00000124505] [ENSMUST00000127756] [ENSMUST00000140975] [ENSMUST00000152065]
Predicted Effect probably benign
Transcript: ENSMUST00000020981
SMART Domains Protein: ENSMUSP00000020981
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
Pfam:CENP-O 1 74 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020984
AA Change: V849A

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000020984
Gene: ENSMUSG00000020654
AA Change: V849A

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111169
SMART Domains Protein: ENSMUSP00000106799
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 118 195 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124505
AA Change: V848A

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122073
Gene: ENSMUSG00000020654
AA Change: V848A

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127110
Predicted Effect probably benign
Transcript: ENSMUST00000127756
AA Change: V849A

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115406
Gene: ENSMUSG00000020654
AA Change: V849A

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140975
SMART Domains Protein: ENSMUSP00000119136
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 117 231 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146523
Predicted Effect probably benign
Transcript: ENSMUST00000152065
AA Change: V848A

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115644
Gene: ENSMUSG00000020654
AA Change: V848A

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152792
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype Strain: 2661086; 3604495
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes adenylyl cyclase 3 which is a membrane-associated enzyme and catalyzes the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This protein appears to be widely expressed in various human tissues and may be involved in a number of physiological and pathophysiological metabolic processes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for one mutation of this gene display impaired olfaction and disorganization of glomeruli in the main olfactory bulb. Mutant animals also appear to be sterile as homozygous matings failed to produce litters. Mice with another mutant allele fail to survive beyond weaning. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)

Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T A 17: 40,880,210 K109N probably benign Het
Ahnak2 G A 12: 112,775,371 P756S probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arhgef38 T C 3: 133,146,473 K319E probably damaging Het
Bbs7 C T 3: 36,592,397 A425T probably damaging Het
Cacna1e T A 1: 154,472,193 R879W probably damaging Het
Cfap65 GTCTT GTCTTCTT 1: 74,927,186 probably benign Het
Cpsf7 T C 19: 10,525,968 probably benign Het
Ctf2 A G 7: 127,719,587 V80A probably benign Het
Ddhd1 A G 14: 45,657,272 L30P probably damaging Het
Eml1 A G 12: 108,536,275 D700G probably benign Het
Epha7 C T 4: 28,947,579 P613L probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Itih3 G A 14: 30,917,664 T400I probably benign Het
Lrrc14 T A 15: 76,713,421 L117Q probably damaging Het
Ncbp1 C T 4: 46,168,530 S626L probably benign Het
Nefh C T 11: 4,939,479 D1047N unknown Het
Ptprm T G 17: 66,944,326 T519P probably damaging Het
Sorl1 T G 9: 41,980,711 D1881A probably damaging Het
Sox12 T C 2: 152,396,797 D301G possibly damaging Het
Vmn2r14 C T 5: 109,224,463 E54K probably benign Het
Vmn2r26 A G 6: 124,061,350 N628S probably damaging Het
Zfp143 G A 7: 110,069,596 V36M possibly damaging Het
Zfp850 A T 7: 27,989,183 N533K possibly damaging Het
Other mutations in Adcy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Adcy3 APN 12 4194357 missense probably damaging 1.00
IGL00985:Adcy3 APN 12 4134600 missense probably damaging 0.98
IGL01735:Adcy3 APN 12 4201213 missense probably benign 0.00
IGL02097:Adcy3 APN 12 4212118 missense probably damaging 1.00
IGL02102:Adcy3 APN 12 4134699 missense probably damaging 1.00
IGL02103:Adcy3 APN 12 4134390 missense possibly damaging 0.69
IGL02155:Adcy3 APN 12 4212142 nonsense probably null
IGL02376:Adcy3 APN 12 4201031 missense possibly damaging 0.77
IGL02411:Adcy3 APN 12 4209407 unclassified probably null
IGL02465:Adcy3 APN 12 4200906 missense probably benign 0.10
IGL02819:Adcy3 APN 12 4206986 splice site probably benign
magnificent_frigatebird UTSW 12 4194324 missense
R0015:Adcy3 UTSW 12 4195260 critical splice donor site probably null
R0015:Adcy3 UTSW 12 4195260 critical splice donor site probably null
R0918:Adcy3 UTSW 12 4198360 missense probably benign 0.05
R1480:Adcy3 UTSW 12 4212171 missense probably damaging 1.00
R1736:Adcy3 UTSW 12 4200998 missense possibly damaging 0.87
R1885:Adcy3 UTSW 12 4134951 missense probably damaging 1.00
R1897:Adcy3 UTSW 12 4173450 splice site probably benign
R1951:Adcy3 UTSW 12 4208624 missense probably benign 0.29
R2083:Adcy3 UTSW 12 4173512 missense probably damaging 1.00
R4379:Adcy3 UTSW 12 4134558 missense probably damaging 1.00
R4785:Adcy3 UTSW 12 4206542 missense probably benign 0.00
R4960:Adcy3 UTSW 12 4134896 missense probably benign 0.11
R5001:Adcy3 UTSW 12 4198434 missense possibly damaging 0.56
R5166:Adcy3 UTSW 12 4134438 missense probably damaging 1.00
R5375:Adcy3 UTSW 12 4210870 missense probably damaging 1.00
R5416:Adcy3 UTSW 12 4209308 missense probably damaging 1.00
R5998:Adcy3 UTSW 12 4198348 missense probably damaging 1.00
R6248:Adcy3 UTSW 12 4208662 critical splice donor site probably null
R6490:Adcy3 UTSW 12 4212150 missense probably damaging 1.00
R6566:Adcy3 UTSW 12 4194324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTAGTCACATGCTGCG -3'
(R):5'- GCTAGCATTTCAGTGAACACC -3'

Sequencing Primer
(F):5'- TAGTCACATGCTGCGGAGGG -3'
(R):5'- TGCCTAGGGTCATCCTGGAG -3'
Posted On2014-11-12